#1 [00:00] <TheSexyISTAustralian> well... my bnc seems to be against chan rules, but your kick reason wasn't nice anyway, so I guess its fine
#2 [00:01] <TheNoodle> lol
#3 [00:01] <TheNoodle> You're own fault :P
#4 [00:01] <TheNytangel> Your*
#5 [00:01] <TheNoodle> was my idea, gimme it back lol
#6 [00:01] <TheSexyISTAustralian> you gunna ban me noodle? I'll take back that cookie I gave you last night
#7 [00:01] <TheSexyISTAustralian> okay you can have it now
#8 [00:02] <TheNoodle> lol
#9 [00:02] <TheNoodle> Thankyou :3
#10 [00:04] * Tsuimonster [Tsuimonster@notlogged] has joined #minecrafthelp
#11 [00:05] * CrusaderDeleters [CrusaderDeleters@notlogged] has joined #minecrafthelp
#12 [00:08] * Chris slaps AuBot
#12 [00:12] * guest-743993-64911 [guest-743993-64911@notlogged] has joined #minecrafthelp
#13 [00:12] <guest-743993-64911> hey guys
#14 [00:21] * oldtopman [oldtopman@notlogged] has joined #minecrafthelp
#15 [00:24] <guest-743993-64911> anyone in here familiar with the "better than wolves mod"?
#16 [00:24] <ThisIsNotChris> ??< mods
#17 [00:24] <ThisIsNotChris> ?? mods
#18 [00:24] <VoxelHead> mods: This channel is not a venue for mod support, or support for modded servers, as it is impossible for anybody to know every combination of mods out there, this channel does not assist with unofficial third-party modded content.
#19 [00:24] <VoxelHead> mods: For single player mods, contact the mod's creator or try http://tiny.cc/modinstall for general installation instructions. For bukkit help, use #bukkit; you can also try using Google to search for a mod's installation instructions.
#20 [00:28] <guest-743993-64911> oi? no no the mod works fine. just having a problem making one elevator work,looking for someone who has pretty knowledge of it.
#21 [00:28] <TheNoodle> Try asking in #bukkit if it's a multiplayer mod or #minecraft if it's for single player :)
#22 [00:29] <guest-743993-64911> oh alright thanks noodle :)
#23 [00:29] * Fred [Fred@notlogged] has joined #minecrafthelp
#24 [00:29] <guest-743993-64911> yeah its singleplayer so ill go there.
#25 [00:29] <guest-743993-64911> yeah its singleplayer so ill go there.
#26 [00:30] * guest-743993-64911 [guest-743993-64911@notlogged] has left #minecrafthelp
#27 [00:34] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#28 [00:37] * Darkwolf44 [Darkwolf44@notlogged] has joined #minecrafthelp
#29 [00:37] <Darkwolf44> .
#30 [00:37] <Darkwolf44> Hello?
#31 [00:37] <Wug> TheNytangel: hallo
#32 [00:37] <TheNytangel> What
#33 [00:37] <Darkwolf44> hey
#34 [00:37] <Wug> lol oops, totally random ping
#35 [00:37] <Wug> Darkwolf44: hallo
#36 [00:37] <TheNytangel> >.>
#37 [00:38] * Wug has kicked TheNytangel from #minecrafthelp (CAKE)
#37 [00:38] <TheBadShepperd> Caaaake.
#38 [00:38] <Darkwolf44> hy
#39 [00:38] <Darkwolf44> hey*
#40 [00:39] <Darkwolf44> i have a minor problem
#41 [00:39] <Wug> :ar
#42 [00:39] <WugBot> ar: Ask a question, recieve an answer.
#43 [00:39] <Darkwolf44> i got mindcraft as a gift from my brother
#44 [00:39] <Darkwolf44> but i can't log in to the game :s
#45 [00:40] <Darkwolf44> and i haven't gotten an e-mail either
#46 [00:41] <Darkwolf44> hello?
#47 [00:42] * Freddy [Freddy@notlogged] has joined #minecrafthelp
#48 [00:43] <Wug> dar ... crap
#49 [00:50] <CrusaderDeleters> lol
#50 [00:50] <CrusaderDeleters> gj wug
#51 [00:51] * mib_blf2qp [mib_blf2qp@notlogged] has joined #minecrafthelp
#52 [00:51] <Aaes> Can someone please help me?
#53 [00:51] * Odysimus [Odysimus@notlogged] has joined #minecrafthelp
#54 [00:52] <Aaes> My minecraft game will not download packages. I need support please?
#55 [00:58] * Aaes [Aaes@notlogged] has joined #minecrafthelp
#56 [00:58] * genshou [genshou@notlogged] has joined #minecrafthelp
#57 [00:59] <Aaes> Anyone here? I need help...
#58 [00:59] <Aaes> And no I dont run Linuz
#59 [00:59] <Aaes> Or os x
#60 [01:05] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#61 [01:12] <Wug> xales: did you forget how to use a keyboard
#62 [01:12] <Wug> xales: did you forget how to use a keyboard
#63 [01:15] * neersighted|AFK [neersighted|AFK@notlogged] has left #minecrafthelp
#64 [01:17] * neersighted [neersighted@notlogged] has joined #minecrafthelp
#65 [01:27] * Keltinray [Keltinray@notlogged] has joined #minecrafthelp
#66 [01:29] * Aaes [Aaes@notlogged] has joined #minecrafthelp
#67 [01:31] * genshou [genshou@notlogged] has joined #minecrafthelp
#68 [01:34] <CrusaderDeleters> wug: where did you get xales from?
#69 [01:35] <Wug> he hasnt said anything in like 3 weeks
#70 [01:35] <Wug> !seen xales
#71 [01:35] <GreyBot> I last saw xales (die@inafire.com) 2days 11hrs 51mins 7secs ago, joining #minecrafthelp.breakroom.
#72 [01:36] <Wug> that would have been rejoining after a netsplit and is thus inconclusive
#73 [01:36] * frogzilla [frogzilla@notlogged] has joined #minecrafthelp
#74 [01:36] <CrusaderDeleters> lol
#75 [01:36] <CrusaderDeleters> lol
#76 [01:37] * frogzilla [frogzilla@notlogged] has left #minecrafthelp
#77 [01:43] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#78 [01:45] * oldtopman [oldtopman@notlogged] has joined #minecrafthelp
#79 [01:47] * Somefellow [Somefellow@notlogged] has joined #minecrafthelp
#80 [01:47] * neersighted [neersighted@notlogged] has joined #minecrafthelp
#81 [01:50] * Somefellow [Somefellow@notlogged] has joined #minecrafthelp
#82 [01:52] * jon1014 [jon1014@notlogged] has joined #minecrafthelp
#83 [01:52] * Wug_ [Wug_@notlogged] has joined #minecrafthelp
#84 [01:52] <jon1014> hey i need help again
#85 [01:52] <jon1014> i need to know how to make a server with the map block hawk down
#86 [01:53] <jon1014> can ayone help?
#87 [01:53] <jon1014> can ayone help?
#88 [01:53] * It [It@notlogged] has left #minecrafthelp
#89 [01:58] * Belutz [Belutz@notlogged] has joined #minecrafthelp
#90 [01:58] * Belutz [Belutz@notlogged] has joined #minecrafthelp
#91 [01:59] * Belutz [Belutz@notlogged] has left #minecrafthelp
#92 [01:59] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#93 [02:01] * Multi [Multi@notlogged] has joined #minecrafthelp
#94 [02:01] <Multi> my friend is getting an error Permission Denied: connect when he tries to join my server but not for any other server
#95 [02:05] <Wug> ;check multi
#96 [02:05] <WugBot> Unable to connect to address: 99-191-36-158.lightspeed.irvnca.sbcglobal.net:25565 (Timed out)
#97 [02:05] <Wug> probably port forwarding
#98 [02:16] <Multi> Wug: this is a dedicated server that many people can connect to just fine
#99 [02:16] <Wug> whats the address?
#100 [02:17] <Wug> also by "any other server" does he mean any local server
#101 [02:19] <Multi> no any remote server, and the address is 72.46.129.42:25565
#102 [02:19] * Campy [Campy@notlogged] has joined #minecrafthelp
#103 [02:19] <Wug> ;check 72.46.129.42:25565
#104 [02:19] <WugBot> 72.46.129.42:25565 seems to host a minecraft server: Proxis RP SMP (12/80)
#105 [02:19] <Wug> probably a firewall on his end
#106 [02:19] <Wug> no idea why
#107 [02:19] <Multi> mmk that seems to be what google is pointing to
#108 [02:20] <Wug> permission denied tends to indicate that something local failed
#109 [02:20] <Wug> as opposed to connection refused, which indicates that nothing was listening remotely
#110 [02:21] <Wug> or timed out, which would indicate that for all intents and purposes, nothing was there at all
#111 [02:21] <Multi> alright thanks Wug
#112 [02:21] * Multitallented [Multitallented@notlogged] has joined #minecrafthelp
#113 [02:43] * Kurimus [Kurimus@notlogged] has joined #minecrafthelp
#114 [02:43] * mib_afmmgs [mib_afmmgs@notlogged] has joined #minecrafthelp
#115 [02:44] <mib_afmmgs> may i ask a question
#116 [02:46] <Wug> :ar
#117 [02:46] <WugBot> ar: Ask a question, recieve an answer.
#118 [02:47] * [AJ] [[AJ]@notlogged] has joined #minecrafthelp
#119 [02:48] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#120 [03:04] * [L] [[L]@notlogged] has joined #minecrafthelp
#121 [03:05] * shay25 [shay25@notlogged] has joined #minecrafthelp
#122 [03:05] <shay25> hey guys
#123 [03:05] <shay25> hey guys
#124 [03:07] * shay25 [shay25@notlogged] has left #minecrafthelp
#125 [03:08] * shay25 [shay25@notlogged] has joined #minecrafthelp
#126 [03:09] <shay25> hey guys
#127 [03:15] * Coll [Coll@notlogged] has joined #minecrafthelp
#128 [03:15] * Coll [Coll@notlogged] has joined #minecrafthelp
#129 [03:18] * Multitallented [Multitallented@notlogged] has left #minecrafthelp
#130 [03:31] * [AJ] [[AJ]@notlogged] has joined #minecrafthelp
#131 [03:41] * Coll [Coll@notlogged] has joined #minecrafthelp
#132 [03:47] * Guest344 [Guest344@notlogged] has joined #minecrafthelp
#133 [03:48] <Guest344> why can't I log in ?
#134 [03:48] <Guest344> my website login doesn't even work anymore, can't log into the game wtf!!!
#135 [03:49] <Thrae> Guest344: Reset your password.
#136 [03:51] * mr_sticky [mr_sticky@notlogged] has joined #minecrafthelp
#137 [03:51] * atliax [atliax@notlogged] has joined #minecrafthelp
#138 [03:54] * mib_1oxc99 [mib_1oxc99@notlogged] has joined #minecrafthelp
#139 [03:55] <mib_1oxc99> guys um i has a quastion..
#140 [03:55] <mib_1oxc99> anyone online?
#141 [03:55] <Thrae> We have answers
#142 [03:56] <Thrae> Everyone gets one question
#143 [03:56] <Thrae> The answer to your question: yes, I am online
#144 [03:56] <Thrae> Thank you for using this channel, you'll get another answer in 24 hours
#145 [03:56] * SoundBomb [SoundBomb@notlogged] has joined #minecrafthelp
#146 [03:56] <SoundBomb> Hello ?
#147 [03:56] <mib_1oxc99> a while back i tried playing minecraft on a netbook , no suprise i got like 2 fps , super laggy .. now i just got super bored and downloaded minecraft with the new 1.9 pre5 and i am getting like 10-15 fps at least maby more
#148 [03:56] <Thrae> SoundBomb: Hi
#149 [03:57] <SoundBomb> Can you help me with account problems ?
#150 [03:57] <mib_1oxc99> what happend i dont understand? why is it running super smoother?
#151 [03:57] <SoundBomb> mib, better code
#152 [03:57] <Thrae> mib_1oxc99: Yeah, 1.9-pre5 has more optimized code along with less requirements. Instead of requiring graphics software from ~2000 it only needs from ~1999.
#153 [03:58] <mib_1oxc99> i c
#154 [03:58] <Thrae> mib_1oxc99: What OS does this Netbook run?
#155 [03:58] <mib_1oxc99> well i am just hoping this can get even beter coding since it would be so amazing to be able to play on my netbook
#156 [03:58] <SoundBomb> Listen, can you guys login right now ?
#157 [03:58] <mib_1oxc99> ye
#158 [03:58] <Thrae> SoundBomb: No, we can't help with account problems, but we can give suggestions.
#159 [03:58] <mib_1oxc99> win7 starter
#160 [03:58] <SoundBomb> well you can login so I don't get it
#161 [03:59] <SoundBomb> was my account banned or something ?
#162 [03:59] * Thrae logs in fine
#162 [03:59] <SoundBomb> does it get deleted if you don't play after a while ?
#163 [03:59] * iDominateU [iDominateU@notlogged] has joined #minecrafthelp
#164 [03:59] <mib_1oxc99> so when i play minecraft well i didnt relly play that much as soon as i saw the amzing results i am trying to see if this is safe,
#165 [03:59] <Thrae> mib_1oxc99: OK, assuming this is an Intel-based netbook, go to http://downloadcenter.intel.com and use its auto-detect to get the latest drivers.
#166 [03:59] <mib_1oxc99> like my laptop gets kinda loud
#167 [04:00] <Thrae> mib_1oxc99: Also look into a program called "GMABooster", as well as a mod called Optifine.
#168 [04:00] <Thrae> Optifine/Optiboost
#169 [04:00] <mib_1oxc99> ok
#170 [04:00] <mib_1oxc99> how do i look up the drivers?
#171 [04:00] <Thrae> SoundBomb: Nope never heard that. What's your username?
#172 [04:00] <Thrae> mib_1oxc99: They have an Auto-Detect feature on that page.
#173 [04:00] <SoundBomb> guess...
#174 [04:00] <SoundBomb> XD
#175 [04:01] <Thrae> !paid SoundBomb
#176 [04:01] <SoundBomb> WHAT!
#177 [04:01] <SoundBomb> that's not fair! then why can't I play?
#178 [04:01] <mib_1oxc99> alright , ill do that right now, how can this help man?
#179 [04:01] <Thrae> SoundBomb: Yeah if it's been paid for it'll never be deleted. Reset your password.
#180 [04:01] <Thrae> mib_1oxc99: Increase your FPS further
#181 [04:01] <mib_1oxc99> i c
#182 [04:01] <SoundBomb> WOW!!!
#183 [04:01] <SoundBomb> IT WORKS!!!
#184 [04:01] <SoundBomb> I LOVE YOU GUYS!!!
#185 [04:02] <SoundBomb> I guess it was a glitch
#186 [04:02] <SoundBomb> ha ha ha
#187 [04:02] <SoundBomb> thanks!
#188 [04:02] <mib_1oxc99> i am really still amazed at how much fps i am getting with this netbook , even though its not nearly enough for best exp
#189 [04:02] <Thrae> SoundBomb: Yeah if you put in your password wrong too many times it'll ban you for X minutes and just not tell you
#190 [04:03] <mib_1oxc99> hey thrar it says theres an update for
#191 [04:03] <Thrae> mib_1oxc99: Minecraft only requires graphics technology from ~2000 (or ~1999 if you're using 1.9). Most of what it needs is a lot of RAM, and your netbook probably has like 2GB, right?
#192 [04:03] <mib_1oxc99> chipset
#193 [04:03] <mib_1oxc99> yeah
#194 [04:03] <Thrae> mib_1oxc99: No harm in updating your drivers, should run smoother
#195 [04:03] <mib_1oxc99> ok do it right now?
#196 [04:04] <Thrae> It will require a reboot
#197 [04:04] <mib_1oxc99> oh
#198 [04:04] <mib_1oxc99> ok can i do that and then come back?
#199 [04:04] <mib_1oxc99> here
#200 [04:04] <Thrae> Sure, I'll be here
#201 [04:04] <mib_1oxc99> hey by the way super thanks man
#202 [04:05] * RichardG [RichardG@notlogged] has joined #minecrafthelp
#203 [04:05] <mib_1oxc99> hey how lon does this install take u know?
#204 [04:06] <Thrae> mib_1oxc99: Shouldn't take more than 15 minutes
#205 [04:09] * panitaliemom [panitaliemom@notlogged] has joined #minecrafthelp
#206 [04:10] <panitaliemom> hey krea u there?
#207 [04:10] <panitaliemom> threa
#208 [04:10] <Thrae> panitaliemom: Yes?
#209 [04:10] <panitaliemom> i was talking to someone but had to reboot
#210 [04:11] <panitaliemom> oh its u sorry lool
#211 [04:11] <panitaliemom> yeah so i rebooted
#212 [04:11] <panitaliemom> and installed the thing
#213 [04:11] <panitaliemom> what was the other thing?
#214 [04:11] <Thrae> panitaliemom: GMABooster, the program, and Optifine/Optiboost, the mod
#215 [04:12] <panitaliemom> u mentioned somekind of mod? of texture pack?
#216 [04:12] * Thayli [Thayli@notlogged] has joined #minecrafthelp
#217 [04:12] <panitaliemom> what is GMAbooster?
#218 [04:12] <panitaliemom> oh yeah before we do this
#219 [04:12] * gartral [gartral@notlogged] has joined #minecrafthelp
#220 [04:12] <Thrae> Program that can increase the power of Intel graphics chipsets for the tradeoff of increased battery usage (no problem if you're plugged in, and you can disable it)
#221 [04:13] <panitaliemom> my laptop getts it fans going like crazy , is that a normal thing ?
#222 [04:13] <Thrae> Are you talking about your laptop or your netbook?
#223 [04:13] <panitaliemom> netbook , i have a good laptop but its a family thing , it would be nice to play mineraft on my netbook sometimes
#224 [04:14] <Thrae> panitaliemom> my laptop getts it fans going like crazy , is that a normal thing ? <-- I was referring to this statement. Is it your netbook's fans which are "going crazy"?
#225 [04:14] <panitaliemom> wait whats this battery usage thing?
#226 [04:14] <panitaliemom> Yes netbook
#227 [04:14] <panitaliemom> hp mini 110-1100
#228 [04:15] <panitaliemom> also i put my laptop on high performance when trying minecraft , thats a good thing right?
#229 [04:15] <Thrae> Some Intel graphics chipsets are underclocked, set to a lower voltage than they can be run at, to increase battery life. GMABooster increases it up to their normal, stable voltage and can double FPS while it's running.
#230 [04:15] <Thrae> You keep saying your laptop, do you mean your netbook?
#231 [04:16] <panitaliemom> sorry yes netbook
#232 [04:16] <panitaliemom> ok how do i get gmabooster , and about this mod? where do i get that what is it?
#233 [04:17] <panitaliemom> i dont wana over heat my netbook here or anything
#234 [04:17] <Thrae> panitaliemom: http://www.gmabooster.com/
#235 [04:18] <panitaliemom> um at best i am getting 10fps
#236 [04:19] <Thrae> panitaliemom: If you're concerned get a USB-connected cooler that the netbook can sit on.
#237 [04:19] <panitaliemom> huh
#238 [04:19] <panitaliemom> um
#239 [04:19] <panitaliemom> so how much fps will i get if i get gmabooster
#240 [04:20] <panitaliemom> i dont wanna do this all just for 2+ fps
#241 [04:20] <panitaliemom> also about the mod? wher i ge that
#242 [04:21] <panitaliemom> hey its asking wat intle card to download gma boosterfor i think , idk if mine on there i has an intel atom
#243 [04:23] <panitaliemom> um
#244 [04:23] <panitaliemom> hello?
#245 [04:23] <panitaliemom> gtg
#246 [04:28] * psypc2 [psypc2@notlogged] has joined #minecrafthelp
#247 [04:32] * Calinou [Calinou@notlogged] has joined #minecrafthelp
#248 [04:35] * Bill [Bill@notlogged] has joined #minecrafthelp
#249 [04:36] * psypc2 [psypc2@notlogged] has joined #minecrafthelp
#250 [04:38] <Thrae> Hi psypc2
#251 [04:46] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#252 [04:57] * Tanjoodo [Tanjoodo@notlogged] has joined #minecrafthelp
#253 [05:00] * pico [pico@notlogged] has joined #minecrafthelp
#254 [05:02] * m0nk [m0nk@notlogged] has joined #minecrafthelp
#255 [05:06] * dalecannon [dalecannon@notlogged] has joined #minecrafthelp
#256 [05:19] * bernard [bernard@notlogged] has joined #minecrafthelp
#257 [05:19] * TheBadShepperd [TheBadShepperd@notlogged] has joined #minecrafthelp
#258 [05:24] * mudpit [mudpit@notlogged] has joined #minecrafthelp
#259 [05:26] * RichardG [RichardG@notlogged] has joined #minecrafthelp
#260 [05:26] * Juze [Juze@notlogged] has joined #minecrafthelp
#261 [05:33] * Endovene [Endovene@notlogged] has joined #minecrafthelp
#262 [05:37] * WTFWatch [WTFWatch@notlogged] has joined #minecrafthelp
#263 [05:43] * Thayli [Thayli@notlogged] has joined #minecrafthelp
#264 [05:49] * timeimp [timeimp@notlogged] has joined #minecrafthelp
#265 [05:51] * x [x@notlogged] has joined #minecrafthelp
#266 [06:06] * iDominateU [iDominateU@notlogged] has joined #minecrafthelp
#267 [06:07] * kermi [kermi@notlogged] has joined #minecrafthelp
#268 [06:12] * petern [petern@notlogged] has joined #minecrafthelp
#269 [06:13] * x_ [x_@notlogged] has joined #minecrafthelp
#270 [06:16] * Thayli [Thayli@notlogged] has joined #minecrafthelp
#271 [06:20] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#272 [06:20] * RobinJ [RobinJ@notlogged] has joined #minecrafthelp
#273 [06:31] * mib_qdrzf4 [mib_qdrzf4@notlogged] has joined #minecrafthelp
#274 [06:31] * Pulec [Pulec@notlogged] has joined #minecrafthelp
#275 [06:43] * Valerie [Valerie@notlogged] has joined #minecrafthelp
#276 [06:54] * Endovene [Endovene@notlogged] has joined #minecrafthelp
#277 [07:00] * bobbymaru [bobbymaru@notlogged] has joined #minecrafthelp
#278 [07:00] <bobbymaru> plz help me
#279 [07:00] <bobbymaru> someone
#280 [07:00] <bobbymaru> anyone there
#281 [07:00] <bobbymaru> i guess not fml
#282 [07:13] * Syndic [Syndic@notlogged] has joined #minecrafthelp
#283 [07:21] * peru_ [peru_@notlogged] has joined #minecrafthelp
#284 [07:22] * m0nk [m0nk@notlogged] has joined #minecrafthelp
#285 [07:25] * Hisui_ [Hisui_@notlogged] has joined #minecrafthelp
#286 [07:25] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#287 [07:28] * mib_xeo5sq [mib_xeo5sq@notlogged] has joined #minecrafthelp
#288 [07:30] * timeimp [timeimp@notlogged] has joined #minecrafthelp
#289 [07:37] * koulchilebaiz [koulchilebaiz@notlogged] has joined #minecrafthelp
#290 [07:38] * AndrewsPanda2 [AndrewsPanda2@notlogged] has joined #minecrafthelp
#291 [07:51] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#292 [07:57] * Bill [Bill@notlogged] has joined #minecrafthelp
#293 [07:58] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#294 [08:02] * Thayli [Thayli@notlogged] has joined #minecrafthelp
#295 [08:07] * peru [peru@notlogged] has joined #minecrafthelp
#296 [08:13] * Thayli [Thayli@notlogged] has joined #minecrafthelp
#297 [08:17] * WTFWatch [WTFWatch@notlogged] has joined #minecrafthelp
#298 [08:19] * frogzilla [frogzilla@notlogged] has joined #minecrafthelp
#299 [08:20] * Fiya [Fiya@notlogged] has joined #minecrafthelp
#300 [08:20] <frogzilla> what does it mean when i dont have enough ram
#301 [08:21] * Blacker47 [Blacker47@notlogged] has joined #minecrafthelp
#302 [08:24] * Sardonicus [Sardonicus@notlogged] has joined #minecrafthelp
#303 [08:25] * dr_bibble [dr_bibble@notlogged] has joined #minecrafthelp
#304 [08:26] <dr_bibble> what does it mean if i dont have emough ram
#305 [08:27] * TehPinkyy [TehPinkyy@notlogged] has joined #minecrafthelp
#306 [08:29] * Thayli [Thayli@notlogged] has joined #minecrafthelp
#307 [08:31] * Iguana [Iguana@notlogged] has joined #minecrafthelp
#308 [08:37] * Me4502 [Me4502@notlogged] has joined #minecrafthelp
#309 [08:37] * fenster [fenster@notlogged] has joined #minecrafthelp
#310 [08:38] <fenster> what does it mean if i dont have enough ram
#311 [08:39] * mib_n439g5 [mib_n439g5@notlogged] has joined #minecrafthelp
#312 [08:45] * sugar [sugar@notlogged] has joined #minecrafthelp
#313 [08:47] <sugar> I just bought Minecraft for my son and we are so upset. He's been dutifully standing and waiting for the black screen to do something. We finally dragged him away. Next morning. Still nothing
#314 [08:53] * oscar [oscar@notlogged] has joined #minecrafthelp
#315 [09:01] * HariboPenguin [HariboPenguin@notlogged] has joined #minecrafthelp
#316 [09:02] * Thols [Thols@notlogged] has joined #minecrafthelp
#317 [09:05] * WoolyBrain [WoolyBrain@notlogged] has joined #minecrafthelp
#318 [09:06] * Me4502 [Me4502@notlogged] has joined #minecrafthelp
#319 [09:07] * brunofarache [brunofarache@notlogged] has joined #minecrafthelp
#320 [09:08] <WoolyBrain> I played 1.7.3 again yesterday and noticed that sheep grew their wool back very quickly in snowy taiga. But my main game in 1.8.1 is on the border between swamp and desert, and I have sheep running around still shorn after five days.
#321 [09:09] <WoolyBrain> Is the climate or the game version the reason for the difference?
#322 [09:09] * oldtopman [oldtopman@notlogged] has joined #minecrafthelp
#323 [09:10] <brunofarache> does anyone know how to play it on mac?
#324 [09:10] * pricklyeagle2010 [pricklyeagle2010@notlogged] has joined #minecrafthelp
#325 [09:12] * Diablodoct0r [Diablodoct0r@notlogged] has joined #minecrafthelp
#326 [09:17] <oldtopman> brunofarache: What version of mac OS are you using?
#327 [09:19] * aikaramba [aikaramba@notlogged] has joined #minecrafthelp
#328 [09:22] * __AvaloN__ [__AvaloN__@notlogged] has joined #minecrafthelp
#329 [09:24] <__AvaloN__> Hello people ... I need help .. i have problem with download MC.exe ... it say s3.amazondawns.com server is not found ... i deleted my mc.exe becouse i cannot update game but now i cant donwload exe.. from site ... (sorry for my english) plz help :(
#330 [09:25] * Tonux [Tonux@notlogged] has joined #minecrafthelp
#331 [09:25] * osteen [osteen@notlogged] has joined #minecrafthelp
#332 [09:26] <__AvaloN__> can any help ? :O
#333 [09:26] <osteen> Anyone here can help me?
#334 [09:26] <osteen> Any minecraft-support can help me here?
#335 [09:27] <oldtopman> !isdown
#336 [09:27] <GreyBot> oldtopman: It's just you. http://www.minecraft.net is up.
#337 [09:27] <oldtopman> ??> osteen ask
#338 [09:27] <VoxelHead> osteen: (ask) Don't ask to ask or just say "I need help" - just ask your question or state what you need help with, and be as specific as possible.
#339 [09:27] <VoxelHead> osteen: (ask) If you are unsure if the question is appropriate, just ask it and you will be informed if it is not.
#340 [09:29] <osteen> I need help changing email on my minecraft account, as someone tried to many times wrong password, so it got blocked..
#341 [09:29] <WoolyBrain> I played 1.7.3 again yesterday and noticed that sheep grew their wool back very quickly in snowy taiga. But my main game in 1.8.1 is on the border between swamp and desert, and I have sheep running around still shorn after five days.Is the climate or the game version the reason for the difference?
#342 [09:31] <osteen> Can anyone help me with my "question"?
#343 [09:31] * Smiley [Smiley@notlogged] has joined #minecrafthelp
#344 [09:32] <osteen> I need help changing email on my minecraft account, as someone tried to many times wrong password, so it got blocked.. Can anyone here help me changing email on the account? If i prove its mine?
#345 [09:33] <fenster> hello im having a problem with my minecraft server it says not enough ram and say server keeps chaning
#346 [09:33] <osteen> Then your pc maybe is too bad to host server ;P
#347 [09:34] <osteen> doesn't looks like someone can help me
#348 [09:35] * Jaska [Jaska@notlogged] has joined #minecrafthelp
#349 [09:35] * sprocket [sprocket@notlogged] has joined #minecrafthelp
#350 [09:36] <sprocket> i dont have enough ram on my server what do i do
#351 [09:36] <osteen> get better pc :P
#352 [09:36] <sprocket> really
#353 [09:44] * Oerg866 [Oerg866@notlogged] has joined #minecrafthelp
#354 [09:45] * WTFWatch [WTFWatch@notlogged] has joined #minecrafthelp
#355 [09:50] * Smarag [Smarag@notlogged] has joined #minecrafthelp
#356 [09:54] * peru_ [peru_@notlogged] has joined #minecrafthelp
#357 [10:02] * Darkwolf44 [Darkwolf44@notlogged] has joined #minecrafthelp
#358 [10:03] <Darkwolf44> Hello?
#359 [10:03] <Darkwolf44> :S
#360 [10:04] <Darkwolf44> Anyone?
#361 [10:05] <Darkwolf44> ...
#362 [10:07] * mib_03cjc5 [mib_03cjc5@notlogged] has joined #minecrafthelp
#363 [10:07] <Darkwolf44> hello?
#364 [10:07] <Darkwolf44> i need help with a minor problem
#365 [10:07] <Darkwolf44> ...
#366 [10:07] <mib_03cjc5> what does it mean it mean i dont have enough ram
#367 [10:08] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#368 [10:08] <Darkwolf44> umm
#369 [10:08] <Darkwolf44> propobly that u doesn't have enough RAM
#370 [10:08] <Darkwolf44> ?
#371 [10:09] <mib_03cjc5> what do i do about it
#372 [10:09] <Darkwolf44> RAM is something the computer has
#373 [10:09] <Darkwolf44> du u have a PC or a laptop?
#374 [10:10] <mib_03cjc5> pc
#375 [10:10] <Darkwolf44> Then u got 2 choices
#376 [10:10] <mib_03cjc5> ok
#377 [10:10] <Darkwolf44> either buy RAM sticks or buy a better PC
#378 [10:10] <Darkwolf44> xD
#379 [10:10] <Darkwolf44> do you know what ur RAM is?
#380 [10:10] <mib_03cjc5> yea\
#381 [10:11] <Darkwolf44> how much RAM do u have?
#382 [10:11] <mib_03cjc5> 4
#383 [10:11] <Darkwolf44> GB?
#384 [10:11] <mib_03cjc5> yea
#385 [10:11] <mib_03cjc5> that what i said
#386 [10:11] <Darkwolf44> i only have 2 GB and no problems
#387 [10:11] <Darkwolf44> xD
#388 [10:11] * _____ [_____@notlogged] has joined #minecrafthelp
#389 [10:11] <mib_03cjc5> maybe i need to increase the ram for the server
#390 [10:12] <mib_03cjc5> idk what the problem
#391 [10:12] <Darkwolf44> server?
#392 [10:12] <Darkwolf44> are we talking about servers??
#393 [10:12] <_____> Okay I have random crashing issues, idk if it is with java or something
#394 [10:12] <Darkwolf44> tell me
#395 [10:12] <mib_03cjc5> yea
#396 [10:12] <_____> But the game just freezes up about 10 minutes in; no error or anything
#397 [10:13] <Darkwolf44> no blue screen?
#398 [10:13] <_____> Windows 7, sometimes it lags a little bit, but nothing major
#399 [10:13] <Darkwolf44> to be honest the 3 of us are all waiting for help
#400 [10:13] <Darkwolf44> xD
#401 [10:14] <_____> IDK if maybe it is java that is the problem? I have java up to date, and am running 1.9.....5? Or 4
#402 [10:14] <_____> Either one does it
#403 [10:14] <Darkwolf44> my problem is that i got Minecraft from my brother but i log in to download it :s
#404 [10:14] <Darkwolf44> Try launch it in XP
#405 [10:14] <Darkwolf44> may solve the problem
#406 [10:16] * Calinou [Calinou@notlogged] has joined #minecrafthelp
#407 [10:16] <Darkwolf44> well no help to get here
#408 [10:19] * lewrolla [lewrolla@notlogged] has joined #minecrafthelp
#409 [10:20] <lewrolla> Hi, how long does it take from when you buy minecraft for it to start working ? I have downloaded it to my pc but cannot run/launch the game. I bought it over 3 hrs ago now.
#410 [10:23] <lewrolla> Any ideas
#411 [10:24] * mr_trousers [mr_trousers@notlogged] has joined #minecrafthelp
#412 [10:25] <_____> Yeah I think it is 5 that I am running; it really makes the game unplayable.
#413 [10:26] <_____> Gosh this is the most helpful channel
#414 [10:26] <_____> Ah well, I suppose it is a tad early for people to clamor into irc
#415 [10:26] * TomRone [TomRone@notlogged] has joined #minecrafthelp
#416 [10:27] * Ludd^ [Ludd^@notlogged] has joined #minecrafthelp
#417 [10:27] * hatman [hatman@notlogged] has joined #minecrafthelp
#418 [10:28] * Emmaisawsome [Emmaisawsome@notlogged] has joined #minecrafthelp
#419 [10:29] <hatman> i have bought minecraft 4 times now and every time i do it says purchase sucsess but after an hour i try to logon and it says user not premuim
#420 [10:30] <hatman> !brenwren paid
#421 [10:30] <Emmaisawsome> my game has downloaded and i sign in at it goes to a black screen. Why does it do this and how can i get onto the game
#422 [10:30] <Emmaisawsome> ??
#423 [10:30] * itsmedamon- [itsmedamon-@notlogged] has joined #minecrafthelp
#424 [10:31] <Emmaisawsome> HELP!!!!!!!
#425 [10:31] <hatman> Hello?
#426 [10:31] <_____> Nobody here is actually helping; everyone is here for their own respective problems
#427 [10:31] <_____> :\
#428 [10:31] <hatman> well i need help
#429 [10:31] <rymate1234> !paid brenwren
#430 [10:31] <_____> As do I, as does emma, as does lerolla
#431 [10:32] <hatman> they were helping yesterday
#432 [10:32] <rymate1234> hatman: you need to wait up to 24 hours for payments to process
#433 [10:32] <hatman> o lol well it said an hour
#434 [10:32] <rymate1234> yea well
#435 [10:33] <rymate1234> ANYONE HAVING PAYMENT PROBLEMS - WAIT 2 HOURS
#436 [10:33] <rymate1234> WAIT
#437 [10:33] <rymate1234> ANYONE HAVING PAYMENT PROBLEMS - WAIT 24 HOURS
#438 [10:33] <rymate1234> as it can take 24 hours
#439 [10:33] <TheNytangel> rymate1234, it can take up to 3 days
#440 [10:33] <rymate1234> stfu
#441 [10:34] <rymate1234> ANYONE HAVING PAYMENT PROBLEMS - WAIT 72 HOURS
#442 [10:34] <TheNytangel> I will if you can get it right
#443 [10:34] * TheNytangel shuts up
#443 [10:34] <TheNytangel> :P
#444 [10:36] * guacamole [guacamole@notlogged] has joined #minecrafthelp
#445 [10:36] <guacamole> How do I install mods?
#446 [10:37] <guacamole> Hur installerar jag mods
#447 [10:37] <TheNytangel> By reading directions
#448 [10:37] <rymate1234> we don't help with mods here
#449 [10:37] <guacamole> ok
#450 [10:37] <TheNytangel> Hur installerar jag mods nein
#451 [10:37] * TheNytangel has no idea what he just said
#451 [10:38] <rymate1234> hurr durr
#452 [10:38] <rymate1234> we no help with mods
#453 [10:38] <rymate1234> #risucraft do
#454 [10:38] <TheNytangel> #mcmods
#455 [10:38] <lewrolla> So, in all seriousness, how long does it take in general. I don't have payment problems, the payment has gone through. I'm having the same issue as emmaisawsome
#456 [10:38] <TheNytangel> #readtheforumposttheygiveyoudirectionsidiot
#457 [10:40] <lewrolla> 72 hrs ?
#458 [10:42] <oldtopman> lewrolla: It dffers, but if you aren't premium in 3 days, email payment@mojang.com with the nature of your request.
#459 [10:42] <lewrolla> ok thanks
#460 [10:46] * aikaramba [aikaramba@notlogged] has joined #minecrafthelp
#461 [10:47] * Michaelwm [Michaelwm@notlogged] has joined #minecrafthelp
#462 [10:51] * mib_i3mkqe [mib_i3mkqe@notlogged] has joined #minecrafthelp
#463 [10:52] <mib_i3mkqe> why is me minecraft not working?
#464 [10:54] * Starkrun [Starkrun@notlogged] has joined #minecrafthelp
#465 [10:55] * Cryp71c [Cryp71c@notlogged] has joined #minecrafthelp
#466 [10:56] * Guest48267 [Guest48267@notlogged] has joined #minecrafthelp
#467 [10:58] <Guest48267> Okay so I switched to W7 recently, Java is latest, and since 1.8 and every prerelease MC crashes after 5 to 15 minutes of play. No bug report or anything, it just freezes. It renders the game completely unplayable.
#468 [10:59] * mib_62dmd5 [mib_62dmd5@notlogged] has joined #minecrafthelp
#469 [11:02] * mib_edayv7 [mib_edayv7@notlogged] has joined #minecrafthelp
#470 [11:03] <mib_edayv7> i have a server and it says not enough ram what do i do
#471 [11:04] * koulchilebaiz [koulchilebaiz@notlogged] has joined #minecrafthelp
#472 [11:05] <oldtopman> mib_edayv7: Buy more RAM.
#473 [11:06] <mib_edayv7> but my computer has 4gb
#474 [11:06] <oldtopman> mib_edayv7: Then allocate more memory.
#475 [11:06] <mib_edayv7> how
#476 [11:07] <GreyVulpine> How are you launching the server?
#477 [11:08] <mib_edayv7> minecraft_server
#478 [11:08] <GreyVulpine> .exe or .jar?
#479 [11:09] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#480 [11:09] <Starkrun> 48267 increase the avalible ram that java can use
#481 [11:10] <mib_edayv7> were do i do that
#482 [11:10] <GreyVulpine> All depends on what you're using to launch minecraft_server.
#483 [11:10] <Starkrun> its nothing about buying more ram its letting java use more
#484 [11:10] <GreyVulpine> are you using minecraft_server.jar?
#485 [11:11] <mib_edayv7> yea jar
#486 [11:11] <GreyVulpine> And you're just double clicking on the .jar, right?
#487 [11:11] <mib_edayv7> yea
#488 [11:11] <GreyVulpine> What operating system are you on? mac?
#489 [11:12] <Guest48267> Okay so I switched to W7 recently, Java is latest, and since 1.8 and every prerelease MC crashes after 5 to 15 minutes of play. No bug report or anything, it just freezes. It renders the game completely unplayable.
#490 [11:12] <Guest48267> Actually it doesn't really render the game at all since the damn thing is frozen
#491 [11:12] <GreyVulpine> Guest48267 - 32 or 64 bit win7? 32 or 64 bit java?
#492 [11:12] <GreyVulpine> What version of java? 6
#493 [11:13] <GreyVulpine> er, 6 or 7?
#494 [11:13] <Guest48267> Latest I think is 7
#495 [11:13] <GreyVulpine> Minecraft and java 7 have reported issues
#496 [11:13] <Guest48267> I think it is 32 bit? I forget; programsx86 means 32 I think
#497 [11:13] <GreyVulpine> RIghtg
#498 [11:13] <Guest48267> so should I roll back to 6?
#499 [11:13] <GreyVulpine> I'd recommend uninstalling java 7 and reinstalling java 6, 64 bit if your OS is 64 bit
#500 [11:13] <mib_edayv7> windows
#501 [11:14] <GreyVulpine> mib_edayv7 - Then why not just download minecraft_server.exe ?
#502 [11:14] <GreyVulpine> It launches the server with the correct memory allocation
#503 [11:14] <mib_edayv7> ill try
#504 [11:14] <Guest48267> okay, I will try that! Thank you
#505 [11:14] <Guest48267> I'll come back if it doesn't work
#506 [11:17] <mib_edayv7> the ram is fixed but now it says this Can't keep up! Did the system time change, or is the server overloaded?
#507 [11:20] <mib_edayv7> what do i do about that
#508 [11:20] * Odysimus [Odysimus@notlogged] has joined #minecrafthelp
#509 [11:22] * mib_vka2q2 [mib_vka2q2@notlogged] has joined #minecrafthelp
#510 [11:22] <mib_vka2q2> hi
#511 [11:23] <mib_vka2q2> my minecraft doesnt work it freezes at the update stage
#512 [11:23] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#513 [11:23] <mib_vka2q2> can anyone help
#514 [11:24] <mib_vka2q2> ok then
#515 [11:26] * WTFWatch [WTFWatch@notlogged] has joined #minecrafthelp
#516 [11:27] * sf [sf@notlogged] has joined #minecrafthelp
#517 [11:29] * AndrewsPanda2 [AndrewsPanda2@notlogged] has joined #minecrafthelp
#518 [11:29] <sf> had to do a system restore on pc today and now minecraft running slow can anyone help
#519 [11:30] * genshou [genshou@notlogged] has joined #minecrafthelp
#520 [11:31] <sf> can anyone help
#521 [11:31] <peru_> yep
#522 [11:31] <sf> thanks
#523 [11:31] <peru_> just stay here long enough and somebody will help
#524 [11:32] <sf> minecraft running slow what do i do
#525 [11:33] * mib_fuweqf [mib_fuweqf@notlogged] has joined #minecrafthelp
#526 [11:33] <mib_fuweqf> just bought the game for my son, dowloaded everything and now it does absolutely nothing, any ideas?
#527 [11:34] * Guest [Guest@notlogged] has joined #minecrafthelp
#528 [11:34] <Guest> So it didn't work
#529 [11:34] <mib_fuweqf> no. running xp, sp2
#530 [11:34] <mib_fuweqf> 3
#531 [11:35] <Guest> I reinstalled java, removed 7 and installed 6.29
#532 [11:35] <Guest> and it still froze
#533 [11:35] <sf> minecraft running slow do i need update of drivers
#534 [11:35] <mib_fuweqf> im at home on my days off and I got to sit at the puter for hours doing this? no wonder my son wants a xbox
#535 [11:35] <mib_fuweqf> pc games are gay
#536 [11:36] <sf> know the feeling
#537 [11:36] <Guest> :|
#538 [11:36] <mib_fuweqf> and these pimple faced kids just got away with my hard earned money arrrggggg
#539 [11:37] <mib_fuweqf> joke
#540 [11:37] <Guest> Windows 7, Java 6.29, MC 1.9_5. After about 10 minutes of gameplay it freezes up, no error message or anything. Sounds continue to play until they are done (so, for example, if a song is playing it will play until the end).
#541 [11:37] <Guest> It makes the game unplayable.
#542 [11:38] * koulchilebaiz_ [koulchilebaiz_@notlogged] has joined #minecrafthelp
#543 [11:38] * guest-0-86546 [guest-0-86546@notlogged] has joined #minecrafthelp
#544 [11:39] <VajraX> Is anyone having problems like me, where Minecraft crashes when you try to run it?
#545 [11:40] <VajraX> It's telling me "Java(TM) Platform SE binary has stopped working" when I try to run the .exe
#546 [11:41] <VajraX> Which is odd, because I'm talking to my girlfriend on MSN, and she's not having any problems
#547 [11:42] * mib_irwnrr [mib_irwnrr@notlogged] has joined #minecrafthelp
#548 [11:42] * quaddle [quaddle@notlogged] has joined #minecrafthelp
#549 [11:43] <mib_irwnrr> hey can u use a visa gift card to buy minecraft
#550 [11:43] <quaddle> hello my minecraft kepps saying it cant connect to minecraft.net server help please
#551 [11:43] * koulchilebaiz_ [koulchilebaiz_@notlogged] has joined #minecrafthelp
#552 [11:45] <quaddle> hello my minecraft kepps saying it cant connect to minecraft.net server help please help i want to play online
#553 [11:45] <VajraX> You're lucky that you can even open it - mine won't even open.
#554 [11:45] <quaddle> do you know whats wrong with ine though
#555 [11:45] <quaddle> *mione
#556 [11:45] <quaddle> *mine
#557 [11:45] <Guest> Windows 7, Java 6.29, MC 1.9_5. After about 10 minutes of gameplay it freezes up, no error message or anything. Sounds continue to play until they are done (so, for example, if a song is playing it will play until the end).
#558 [11:45] <Guest> It makes the game unplayable.
#559 [11:45] <VajraX> no, I'm not one of the support team
#560 [11:46] * Thayli [Thayli@notlogged] has joined #minecrafthelp
#561 [11:46] <quaddle> well who can help me then
#562 [11:46] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#563 [11:46] <VajraX> I don't know, but you'll have to be more patient than that
#564 [11:47] <quaddle> okie dokie well hows your day been and i have it for 5 months and it still wont let me
#565 [11:51] * bunny993 [bunny993@notlogged] has joined #minecrafthelp
#566 [11:52] <bunny993> the stupid game wont let me update and wont let me play with out updating all it says is access denied
#567 [11:54] <bunny993> can any of you help me
#568 [11:54] <bunny993> hello?
#569 [11:54] <VajraX> bunny, not many support team members are on right now, it seems
#570 [11:55] <bunny993> really so alot of people are having trouble right now
#571 [11:55] <VajraX> I know *I* am
#572 [11:56] <VajraX> the damn thing won't even open for me
#573 [11:57] <bunny993> i mean it might just be my mom blocking it but normaly she woulnt do that and wow that sucks
#574 [11:57] * quibbit [quibbit@notlogged] has joined #minecrafthelp
#575 [11:58] <Guest> Windows 7, Java 6.29, MC 1.9_5. After about 10 minutes of gameplay it freezes up, no error message or anything. Sounds continue to play until they are done (so, for example, if a song is playing it will play until the end).
#576 [11:58] <Guest> It makes the game unplayable.
#577 [11:58] <bunny993> dod you need to download aanythinng new for the new updates
#578 [11:58] <VajraX> not that I know of
#579 [11:58] <quibbit> i bought minecraft and the transaction worked. I did not get a confirmation email though and it has already been 8 hours. Will they send it to me?
#580 [11:58] <VajraX> I don't do prerealses
#581 [11:58] <bunny993> do*
#582 [11:58] <VajraX> prereleased*
#583 [11:58] <VajraX> es*
#584 [11:58] <VajraX> dammit, I can't spell
#585 [11:59] <bunny993> ya they will it takes a while though
#586 [11:59] <quibbit> HELP ME NOW WITH THE CONFIRMATION EMAIl
#587 [11:59] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#588 [11:59] <quibbit> sorry thanks
#589 [11:59] <bunny993> ITS OK
#590 [11:59] <bunny993> lol
#591 [11:59] <quibbit> fart
#592 [11:59] <bunny993> eeeeeeewwwwww
#593 [11:59] <VajraX> ugh, this was working yesterday
#594 [12:00] <VajraX> even reinstalling java doesn't work
#595 [12:00] <bunny993> well i havent played in a ehile do you think thats the problem
#596 [12:00] <bunny993> while*
#597 [12:00] <VajraX> I wouldn't know, I'm not part of the support team
#598 [12:01] <bunny993> sorry just learning how to type the right way
#599 [12:02] <bunny993> i nees to install the two new updated but it wont let me it says access denied so then i dont update it and try to play and minecraft crashes
#600 [12:02] <bunny993> need*
#601 [12:03] <bunny993> updates*
#602 [12:03] <bunny993> so enraging!!!!!!!!
#603 [12:04] <bunny993> hello?
#604 [12:05] <Guest> Windows 7, Java 6.29, MC 1.9_5. After about 10 minutes of gameplay it freezes up, no error message or anything. Sounds continue to play until they are done (so, for example, if a song is playing it will play until the end).
#605 [12:05] <Guest> It makes the game unplayable.
#606 [12:05] * mib_ahv9ab [mib_ahv9ab@notlogged] has joined #minecrafthelp
#607 [12:06] <bunny993> well that happened to me you need to close the tab then go back in and relog in that should work
#608 [12:06] <bunny993> well it did for me
#609 [12:06] <Guest> ...what? I am using the windowed version.
#610 [12:07] <bunny993> try the in browser
#611 [12:07] <Guest> That might crash the browser completely
#612 [12:07] <Guest> I'll risk it
#613 [12:08] <bunny993> no it wont trust me just play in browser will that how i play anyway ot should work
#614 [12:08] <bunny993> it*
#615 [12:09] <bunny993> do can anyone help me
#616 [12:09] <bunny993> so?
#617 [12:10] <bunny993> i really want to play
#618 [12:10] <bunny993> SO!!!!!!
#619 [12:10] <Guest> It doesn't work on browser O:
#620 [12:10] <bunny993> hello?
#621 [12:11] <bunny993> did you log out and log backin
#622 [12:11] <Chris|AFK> did you try the browser version?
#623 [12:12] * Kreeper [Kreeper@notlogged] has joined #minecrafthelp
#624 [12:12] <Guest> I am using the browser version; it download packages and then black screen
#625 [12:12] <Guest> And then it just stops
#626 [12:12] <Chris|AFK> uuhh... try reinstalling java
#627 [12:12] * mib_4x77q6 [mib_4x77q6@notlogged] has joined #minecrafthelp
#628 [12:12] <Chris|AFK> ??< index
#629 [12:13] <Guest> I did
#630 [12:13] <Guest> Like half an hour ago
#631 [12:13] <bunny993> try doing the process again
#632 [12:13] <Chris|AFK> your graphics card drivers up to date?
#633 [12:13] <Guest> I just logged out and in again
#634 [12:13] <bunny993> it worked for me
#635 [12:13] <Chris|AFK> Guest, windows?
#636 [12:13] <bunny993> so sorry
#637 [12:13] <Guest> Graphics driver shouldn't be the issue because minecraft is crashing not the whole thing
#638 [12:13] <Guest> windows 7 32b
#639 [12:13] <Guest> 1.9_5 java 6.29
#640 [12:14] <Chris|AFK> ?? win/profile
#641 [12:14] <VoxelHead> win/profile: It may be helpful to isolate whether this is a problem with your user account, or with your system as a whole.
#642 [12:14] <Guest> In windowed mode it just crashes after about 15 minutes no error message or anything
#643 [12:14] <VoxelHead> win/profile: Please create a new user profile (a computer user, not a new Minecraft account), log in as that user, and try Minecraft from there. If it works, there's something on your profile that's breaking Java or Minecraft. If not, there's something amiss with your system as a whole.
#644 [12:14] <bunny993> well anyway can anyone help me with my problem
#645 [12:14] <Chris|AFK> bunny, did you try the online client
#646 [12:14] <mib_4x77q6> anybody who can help me? when i start the game i have no sound. i go to options and at the moment i click music or sound it crashes.
#647 [12:14] <Guest> Voxel when I play offline on windowsmode it does the same thing
#648 [12:14] <Chris|AFK> vox's a bot
#649 [12:15] <Guest> really?
#650 [12:15] <Guest> huh
#651 [12:15] <bunny993> wahts that
#652 [12:15] <Guest> OK let me try it
#653 [12:15] <bunny993> whats the online client
#654 [12:16] <bunny993> hello
#655 [12:16] <Chris|AFK> ?? patience
#656 [12:16] <Chris|AFK> ?? patience
#657 [12:16] <VoxelHead> patience: Please be patient when waiting for a response. Many of the helpers here are helping in their free time at school or work, and often get called away.
#658 [12:16] <VoxelHead> patience: In short, your supplications will be answered, in the order in which they are received. See also ?? attitude.
#659 [12:16] <Chris|AFK> http://www.minecraft.net/play
#660 [12:16] <bunny993> sorry
#661 [12:16] * Smiley [Smiley@notlogged] has joined #minecrafthelp
#662 [12:17] <bunny993> still wont work dumb computer
#663 [12:17] * moky [moky@notlogged] has joined #minecrafthelp
#664 [12:17] <Chris|AFK> did you reinstall java?
#665 [12:17] <bunny993> how do you do that
#666 [12:17] <Chris> ??< win/reinst
#667 [12:18] <Chris> uuh thats not it xD
#668 [12:18] <Chris> um.. 1 moment
#669 [12:18] <bunny993> ok
#670 [12:18] <Chris> ??< win/javara
#671 [12:18] <Chris> ?? win/javara
#672 [12:18] <VoxelHead> win/javara: JavaRa is a tool for removing broken Java installations. If your java installation is failing with errors, running JavaRa might clear them up.
#673 [12:18] <Chris> try that
#674 [12:18] <VoxelHead> win/javara: JavaRa's info and download website is: http://raproducts.org/wordpress/software
#675 [12:19] <bunny993> ok but what do you do with it
#676 [12:19] <bunny993> sorry im slow
#677 [12:20] <Chris> http://www.thewebatom.net/content/scripts/cc/click.php?id=24
#678 [12:22] * homeworlder [homeworlder@notlogged] has joined #minecrafthelp
#679 [12:22] * mib_o6mbga [mib_o6mbga@notlogged] has joined #minecrafthelp
#680 [12:23] * Nikigirl123 [Nikigirl123@notlogged] has joined #minecrafthelp
#681 [12:23] <Nikigirl123> um hi
#682 [12:23] <Nikigirl123> i need help
#683 [12:23] <Chris> what with?
#684 [12:23] <Chris> what with?
#685 [12:24] * moky [moky@notlogged] has left #minecrafthelp
#686 [12:24] <Nikigirl123> Well when i go on minecraft.net and try to go to a server it doesn't work and before it worked.
#687 [12:24] <Nikigirl123> i think it's the 1.8.1
#688 [12:24] <Painy> anybody who can help me? when i start the game i have no sound. i go to options and at the moment i click music or sound it crashes.
#689 [12:25] <Chris> Nikigirl123, what do you mean, it doesn't work?
#690 [12:25] <Guest> Okay so somehow that did work; the online client only doesn't work for this user
#691 [12:25] <Guest> let me uninstall the bin
#692 [12:25] <Nikigirl123> ok?
#693 [12:25] <Chris> Nikigirl123, what do you mean, it doesn't work?
#694 [12:26] <Nikigirl123> Well i go on minecraft.net
#695 [12:26] <Nikigirl123> it says
#696 [12:26] <bunny993> ok im going to see if it works now
#697 [12:26] <Nikigirl123> An error while lodaing the applet.
#698 [12:27] <Nikigirl123> It's just a problem with my computer i think
#699 [12:27] <Nikigirl123> ...
#700 [12:27] * CruelNoise_ [CruelNoise_@notlogged] has joined #minecrafthelp
#701 [12:27] <bunny993> STILL DOSNT WORK !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
#702 [12:27] <Nikigirl123> Or um reset the site and put it back on
#703 [12:27] <Chris> bunny, calm it
#704 [12:28] <Nikigirl123> It still doesn't work
#705 [12:28] <Chris> try downloading the client instead of playing in browser
#706 [12:28] <Guest> Windows 7, Java 6.29, MC 1.9_5. After about 10 minutes of gameplay it freezes up, no error message or anything. Sounds continue to play until they are done (so, for example, if a song is playing it will play until the end).
#707 [12:28] <Nikigirl123> What do you mean?
#708 [12:28] <Chris> Guest, does the same thing happen in 1.8?
#709 [12:28] * Morrolan [Morrolan@notlogged] has joined #minecrafthelp
#710 [12:28] <Chris> Niki, download and run minecraft
#711 [12:28] <bunny993> ok
#712 [12:28] * Crafter [Crafter@notlogged] has joined #minecrafthelp
#713 [12:29] <Chris> are you on windows?
#714 [12:29] <Nikigirl123> no on go to minecraft.net
#715 [12:29] <bunny993> me no
#716 [12:29] * hatman [hatman@notlogged] has joined #minecrafthelp
#717 [12:29] <Nikigirl123> and when i go to a server it doesn't work
#718 [12:29] <Nikigirl123> How do you get colored names?>
#719 [12:29] <Crafter> So. I need help. I'm trying to install minecraft but it keeps stopping at Downloading Packages.
#720 [12:30] <Chris> Crafter, got any sort of antivirus installed?
#721 [12:30] <Crafter> Nope.
#722 [12:30] <Guest> I don't recall whether it worked in 1.8 or not on windowed mode; let me check back with you on that
#723 [12:30] <Guest> brb
#724 [12:30] * Aaronzz [Aaronzz@notlogged] has joined #minecrafthelp
#725 [12:31] <Nikigirl123> I just downloaded the thing that it said u can play online and it dont work.
#726 [12:31] <Aaronzz> Timeout error occurred trying to start MySQL Daemon.
#727 [12:31] <bunny993> bye
#728 [12:31] <Chris> Niki, tell me exactly what happens
#729 [12:31] <Chris> bye bye
#730 [12:31] * mib_vszqnz [mib_vszqnz@notlogged] has joined #minecrafthelp
#731 [12:31] <Chris> Aaronzz, debian
#732 [12:31] <Nikigirl123> ok well you go on minecraft.net
#733 [12:31] * Direct1221 [Direct1221@notlogged] has joined #minecrafthelp
#734 [12:31] <Nikigirl123> it says Play Minecraft Classic (Outdated, but free): Single player | Multi player
#735 [12:31] <Chris> classic or beta?
#736 [12:31] <Chris> can't help you now
#737 [12:32] <Chris> cause its classic
#738 [12:32] <Nikigirl123> press on Multi
#739 [12:32] <Nikigirl123> Aweee well thats dymb
#740 [12:32] <Nikigirl123> dumb
#741 [12:32] <Chris> I've never used classic, and we don't support it here I don't believe
#742 [12:32] <Nikigirl123> k go on minecraft.net
#743 [12:32] <mib_vszqnz> I am having trouble loging in to Minecraft from my pc its telling me it cannot connect to minecraft.net
#744 [12:32] <Crafter> Also, when I try playing on the website, it doesn't update there either. It stops on the same screen.
#745 [12:32] <Nikigirl123> yep.
#746 [12:32] <Chris> ?? win/reinst
#747 [12:32] <VoxelHead> win/reinst: You may need to reinstall the locally installed files that Minecraft puts into place.
#748 [12:32] <Nikigirl123> If notch ever comes on here tell him the problem
#749 [12:32] <VoxelHead> win/reinst: To do so, press your Windows+R keys, type in %AppData% at the dialog, and press Enter. In the window that appears, open the .minecraft directory, and delete everything except for the saves directory that you see therein. Then, try running Minecraft again. Good luck!
#750 [12:33] <Nikigirl123> ?
#751 [12:33] <Crafter> I've already tried that.
#752 [12:33] <Nikigirl123> yeah
#753 [12:33] <Nikigirl123> yeah
#754 [12:33] * Aaronzz [Aaronzz@notlogged] has left #minecrafthelp
#755 [12:33] * Aaronzz [Aaronzz@notlogged] has joined #minecrafthelp
#756 [12:33] * Aaronzz [Aaronzz@notlogged] has joined #minecrafthelp
#757 [12:33] * Aaronzz [Aaronzz@notlogged] has left #minecrafthelp
#758 [12:34] <Nikigirl123> And um
#759 [12:34] <Nikigirl123> Well
#760 [12:34] <Nikigirl123> Some one please make a server
#761 [12:34] <Nikigirl123> new called
#762 [12:34] <Nikigirl123> what ever u want
#763 [12:34] <Nikigirl123> then tell me the name
#764 [12:34] <Nikigirl123> what it's on
#765 [12:34] <Nikigirl123> and promote me
#766 [12:35] <Nikigirl123> i have to go
#767 [12:35] <Nikigirl123> bye
#768 [12:35] * Sami345 [Sami345@notlogged] has joined #minecrafthelp
#769 [12:36] <Sami345> I have a problem with Minecraft forums. I have an old account and I think I have lost my password but when I try to recover it I only get error "502 Bad Gateway".
#770 [12:36] <Sami345> I have a problem with Minecraft forums. I have an old account and I think I have lost my password but when I try to recover it I only get error "502 Bad Gateway".
#771 [12:37] * Direct1221 [Direct1221@notlogged] has left #minecrafthelp
#772 [12:38] <Guest> Okay it crashed; 1.8 does not work in windowed mode either
#773 [12:38] <Guest> Windows 7, Java 6.29, MC 1.9_5. After about 10 minutes of gameplay it freezes up, no error message or anything. Sounds continue to play until they are done (so, for example, if a song is playing it will play until the end).
#774 [12:38] * TheRandomGuy [TheRandomGuy@notlogged] has joined #minecrafthelp
#775 [12:38] <TheRandomGuy> Hey guys, got a problem with the memory
#776 [12:39] <Chris> ?? win/launch
#777 [12:39] <VoxelHead> win/launch: If you need to launch minecraft with more ram than the defaults, download this script to the location of minecraft.exe and run it. Java must be in your path for this to work.
#778 [12:39] <VoxelHead> win/launch: Windows Launch Script: http://mcfaq.hfbgaming.com/tools/MoreRAMMCLauncher.bat
#779 [12:39] * wikkit [wikkit@notlogged] has joined #minecrafthelp
#780 [12:40] * Smiley [Smiley@notlogged] has joined #minecrafthelp
#781 [12:41] <Crafter> So I've tried deleting my .minecraft folder. But I still can't get past downloading packages.
#782 [12:41] <TheRandomGuy> Im downloading the more ram thingie
#783 [12:41] <Chris> no antiviruses, ever had an antivirus crafter?
#784 [12:41] <Crafter> No.
#785 [12:43] <Chris> and you reinstalled java?
#786 [12:43] * Endovene [Endovene@notlogged] has joined #minecrafthelp
#787 [12:43] <Crafter> I've tried. But I keep getting errors when I'm trying to update. It's odd because minecraft was working this morning until I tried to force update.
#788 [12:43] <TheRandomGuy> So, the memory problem, if anyone can help please say :)
#789 [12:44] <Chris> did you do the more ram thingy?
#790 [12:45] <Guest> Windows 7, Java 6.29, MC 1.9_5. After about 10 minutes of gameplay it freezes up, no error message or anything. Sounds continue to play until they are done (so, for example, if a song is playing it will play until the end).
#791 [12:45] <TheRandomGuy> Guest
#792 [12:45] <TheRandomGuy> Have you got the latest graphics dirver form Nvidia?
#793 [12:45] <TheRandomGuy> driver*
#794 [12:46] <TheRandomGuy> from* fml
#795 [12:46] <Calinou> Guest: do you have a hs_err_pid***.log in the folder where you run Minecraft (or desktop)?
#796 [12:46] <Calinou> ?? pastebin
#797 [12:46] <VoxelHead> pastebin: Pastebin is a service run at http://www.pastebin.com/ which facilitates the sharing of information without flooding IRC channels. Paste your text there, click 'Submit', and give us the URL the site takes you to, and we can see what you have pasted.
#798 [12:47] <Guest> I don't know where to find that
#799 [12:47] <Guest> in the .minecraft folder?
#800 [12:47] <TheRandomGuy> Guys, how do you run voice chat on here?
#801 [12:48] <Guest> There is no such file on my desktop, nor in the .minecraft folder
#802 [12:49] <Guest> There is also no crash report on the window; it just freezes
#803 [12:50] <TheRandomGuy> Guest what operating system have you got?
#804 [12:50] * xorcon [xorcon@notlogged] has joined #minecrafthelp
#805 [12:50] <xorcon> hey threa u there?
#806 [12:50] <Guest> Win7 32b
#807 [12:50] <Guest> Java 6.29
#808 [12:50] <Guest> MC 1.9_5 (1.8 doesn't work either, though)
#809 [12:51] <TheRandomGuy> Have you got the new downloadable graphics driver from Nvidia?
#810 [12:51] <xorcon> is thea here?
#811 [12:51] <Guest> IDK; I recently changed cards so it might be the reason
#812 [12:51] <Guest> but it is java that stops working, not the driver
#813 [12:52] <TheRandomGuy> Ok, there must be something wrong with the operating system
#814 [12:52] <TheRandomGuy> Java has a daemon thread, so put that on pastebin
#815 [12:52] <TheRandomGuy> ?? pastebin
#816 [12:52] <VoxelHead> pastebin: Pastebin is a service run at http://www.pastebin.com/ which facilitates the sharing of information without flooding IRC channels. Paste your text there, click 'Submit', and give us the URL the site takes you to, and we can see what you have pasted.
#817 [12:52] <Guest> Where is the thread
#818 [12:52] * Iguana [Iguana@notlogged] has joined #minecrafthelp
#819 [12:52] <TheRandomGuy> use that, but I'm not an actual operator on here
#820 [12:52] <TheRandomGuy> It is a hs_pd_err
#821 [12:52] <xorcon> hey guy on here yesterfday told me something about a mod that might help with fps
#822 [12:53] <TheRandomGuy> I'm trying to think
#823 [12:53] <Guest> No results in search
#824 [12:53] <TheRandomGuy> Right
#825 [12:53] <xorcon> i am on a netbook so yeah , also some program called gmabooster or something like that, but lets talk about the mod first , what was it?
#826 [12:53] <TheRandomGuy> Google is always there, just dont close this down yet
#827 [12:53] <TheRandomGuy> Look up on the forums
#828 [12:54] <TheRandomGuy> or go on GetSatisfaction from mojang
#829 [12:54] <Guest> Me or xorcon
#830 [12:54] <TheRandomGuy> You
#831 [12:54] <xorcon> so u guys are just egnoring me?
#832 [12:54] <xorcon> ....
#833 [12:54] <Guest> The daemon thread doesn't exist on C:/
#834 [12:54] <TheRandomGuy> I'm trying to help Guest, patience xorcon
#835 [12:54] <xorcon> k
#836 [12:55] <Guest> I checked getsatisfaction/forum, there does not seem to be any mention of this bug
#837 [12:55] <TheRandomGuy> Ignore that thread atm
#838 [12:55] <TheRandomGuy> If you have command prompt
#839 [12:55] <TheRandomGuy> use that in a min
#840 [12:55] <TheRandomGuy> Theres a certain code to see the thread without the notepad file
#841 [12:55] <Guest> okay what do I input
#842 [12:55] <TheRandomGuy> I'll find out brb
#843 [12:56] * quibbit [quibbit@notlogged] has joined #minecrafthelp
#844 [12:56] <TheRandomGuy> Guest, go on this link
#845 [12:56] <TheRandomGuy> http://www.skylit.com/javamethods/faqs/javaindos.html
#846 [12:57] <TheRandomGuy> See if that can help
#847 [12:57] <xorcon> huryyyyyyyyyyyyyyy up
#848 [12:57] <TheRandomGuy> xorcon, whats the prob?
#849 [12:57] * craftman_6000 [craftman_6000@notlogged] has joined #minecrafthelp
#850 [12:57] <quibbit> hi I loaded java 7, then the packages seem to download, then the game fails while loading I have the error report for someone to look at, what can I do ?
#851 [12:58] <xorcon> i am on a netbook , and i get only like 10 fps , i used to get 2 , now with pre5 i get 10, so i am wonderingt is there any way to further increase the fps
#852 [12:58] <TheRandomGuy> Ok, let me search that up for you
#853 [12:58] <xorcon> some guy told me about a gmabooster or osmething , and a mod
#854 [12:58] <xorcon> i wanna hear about the mod ?
#855 [12:58] <craftman_6000> if i buy minecraft, can i use it on multiple PCs in my house?, or other houses?
#856 [12:58] <TheRandomGuy> xorcon, use this link
#857 [12:58] <TheRandomGuy> http://gaming.stackexchange.com/questions/24836/how-can-i-increase-my-fps-in-minecraft
#858 [12:59] <TheRandomGuy> craftman-6000 I think you can, but I'm not too sure
#859 [12:59] <TheRandomGuy> If you log on the official website
#860 [12:59] <TheRandomGuy> It should know if you have Minecraft or not
#861 [12:59] <TheRandomGuy> You can play it on the browser I think if you log on
#862 [13:00] <Guest> I don't understand what you intend that I do with command prompt
#863 [13:00] <Guest> I'll wait for you to finish helping xorcon
#864 [13:00] <xorcon> so do i download this?
#865 [13:00] <xorcon> http://evilmousestudios.com/tronic/
#866 [13:00] <TheRandomGuy> Guest, did you check through that site?
#867 [13:00] <craftman_6000> i was not sure if it was more web based so i can log on and play anywhere, or if its like iTunes where u are allowed only so many PCs
#868 [13:01] <TheRandomGuy> xorcon, let me check the link
#869 [13:01] <quibbit> the randomguy, did you see my question?
#870 [13:01] <TheRandomGuy> I dont think so, its only a texture pack
#871 [13:01] <TheRandomGuy> quibbit, no sorry
#872 [13:02] <TheRandomGuy> xorcon its HD so it woild probably slow down the fps
#873 [13:02] <xorcon> so
#874 [13:02] <TheRandomGuy> would*
#875 [13:02] <quibbit> here it is again - hi I loaded java 7, then the packages seem to download, then the game fails while loading I have the error report for someone to look at, what can I do ?
#876 [13:02] <xorcon> omg
#877 [13:02] <xorcon> ok there was a mod mentioned that could increase fps , what was it?
#878 [13:02] <xorcon> u know?
#879 [13:03] <Guest> optifine
#880 [13:03] <TheRandomGuy> quibbit, I'm not sue on the hs_pd_err files so, try asking someone else, but if I were you I would put it on pastebin
#881 [13:03] <TheRandomGuy> ?? pastebin
#882 [13:03] <VoxelHead> pastebin: Pastebin is a service run at http://www.pastebin.com/ which facilitates the sharing of information without flooding IRC channels. Paste your text there, click 'Submit', and give us the URL the site takes you to, and we can see what you have pasted.
#883 [13:03] <xorcon> optifine?
#884 [13:03] <Guest> http://www.minecraftforum.net/topic/249637-181-optifine-hd-d2-fps-boost-hd-textures/
#885 [13:03] <quibbit> ok
#886 [13:04] <xorcon> therandomguy
#887 [13:04] <xorcon> optifine?
#888 [13:04] <TheRandomGuy> sounds good
#889 [13:04] <TheRandomGuy> Give it a go
#890 [13:04] <Guest> optifine --> better fps
#891 [13:04] <TheRandomGuy> You should have at leat 20fps on a really bad day
#892 [13:04] <TheRandomGuy> least*
#893 [13:05] * bernard [bernard@notlogged] has joined #minecrafthelp
#894 [13:05] <xorcon> i get 10
#895 [13:05] <TheRandomGuy> And it doubles it, and thats common
#896 [13:05] <xorcon> i get 60 on my other pc , but i wanna see how far i can go with this netbook
#897 [13:05] <Guest> actually optifine mentions a "lag spike of death" which sounds similar to my bug
#898 [13:05] <xorcon> plus the other pc is a family computer
#899 [13:05] <Guest> I will look into this
#900 [13:06] <xorcon> ok guys ill give optifine try and let u know
#901 [13:06] <TheRandomGuy> GL :)
#902 [13:06] * mib_nstgpj [mib_nstgpj@notlogged] has joined #minecrafthelp
#903 [13:06] <TheRandomGuy> OK, thats weird, I came on here for a solution to a problem and now I'm helping everyone else lol
#904 [13:07] <quibbit> theRandomGuy ok here is the link http://pastebin.com/nwU2Ft9r
#905 [13:07] <TheRandomGuy> thanks
#906 [13:07] <quibbit> you are doing a good job ! (I hope :) )
#907 [13:07] <mib_nstgpj> hi my minecraft dosent work in the download and it did it the browser but when i tried to get 1.9 it went to just a white screen. i am using a mac
#908 [13:08] <TheRandomGuy> quibbit, thanks dude
#909 [13:08] <TheRandomGuy> It says you are on windows xp
#910 [13:08] <quibbit> yes
#911 [13:08] <mib_nstgpj> me?
#912 [13:08] <mib_nstgpj> oh
#913 [13:08] <quibbit> xp here -
#914 [13:08] <TheRandomGuy> So, you might want to check on the forums on how to run Minecraft on the family model
#915 [13:09] <TheRandomGuy> It said you had the family model anyway
#916 [13:09] <quibbit> me, yes I think so
#917 [13:09] <TheRandomGuy> That might have something to do with it
#918 [13:09] * Darwin [Darwin@notlogged] has joined #minecrafthelp
#919 [13:09] <xorcon> hey it says download 1 an downlload 2
#920 [13:09] <quibbit> ok, i will look into that thanks
#921 [13:09] <xorcon> do i have to download 2?
#922 [13:09] <xorcon> and also where do i put the file afte ri downloaded it
#923 [13:10] <TheRandomGuy> I'll check into t
#924 [13:10] <TheRandomGuy> it*
#925 [13:10] <mib_nstgpj> hi my minecraft dosent work in the download and it did it the browser but when i tried to get 1.9 it went to just a white screen. i am using a mac
#926 [13:10] <TheRandomGuy> one minute
#927 [13:11] <Darwin> Where do I go? My account lost premium.
#928 [13:11] <xorcon> do i put it in my texturepack folder
#929 [13:11] <TheRandomGuy> I would think so
#930 [13:11] <TheRandomGuy> mib_nstgpj look up on the forums to see how you can run 1.9 on a mac
#931 [13:12] <TheRandomGuy> Darwin go on the official site minecraft.net and go on the help section
#932 [13:12] <TheRandomGuy> They should help you form there
#933 [13:12] <TheRandomGuy> from*
#934 [13:13] <xorcon> hey the menu screen make me lag is there any way of bringing the old one back?
#935 [13:13] * Syndic [Syndic@notlogged] has joined #minecrafthelp
#936 [13:13] <TheRandomGuy> OK, go into your documents I think
#937 [13:13] <xorcon> me?
#938 [13:13] * xxDFBxx [xxDFBxx@notlogged] has joined #minecrafthelp
#939 [13:14] <TheRandomGuy> yeah
#940 [13:14] <xorcon> also the optifine things working
#941 [13:14] <xorcon> what about
#942 [13:14] <TheRandomGuy> Go on your PC's name thing, like mine is harvey'spc
#943 [13:14] <TheRandomGuy> If you wantto delete the optifine thing then do as I say
#944 [13:14] <xxDFBxx> question will making a multiplayer server delete your single player game?
#945 [13:14] <xorcon> wait what
#946 [13:15] <TheRandomGuy> xxDFBxx I think thats coming out in the beta
#947 [13:15] <xorcon> optifinje isnt even workin
#948 [13:15] <TheRandomGuy> OK, so do you want to delete it? Soz, I'm talking to say amny people :P
#949 [13:15] <TheRandomGuy> so many*
#950 [13:15] <xorcon> um sure i know how
#951 [13:15] <TheRandomGuy> Do that then, and see what happens
#952 [13:15] <xorcon> brb , and tell me what the hell i can do to make minecraft fps better
#953 [13:15] <TheRandomGuy> ok
#954 [13:15] <xxDFBxx> what? im playing 1.8 right now but i wanna make a server, but i dont know if it will delete my single player game
#955 [13:17] <xxDFBxx> hello?
#956 [13:17] <xorcon> omg
#957 [13:17] <xxDFBxx> lol
#958 [13:17] <xorcon> OK , so what can i do
#959 [13:17] <TheRandomGuy> xorcon go on this, and look at the Increasing FPS section, second one down http://www.minecraftwiki.net/wiki/Frames_Per_Second
#960 [13:18] <TheRandomGuy> Go on the options section in game
#961 [13:18] <TheRandomGuy> xxdfbxx I dont think it will, check out the mineraft forums
#962 [13:18] <TheRandomGuy> minecraft*
#963 [13:19] <xorcon> no
#964 [13:19] <xorcon> i am done i am tired of reading
#965 [13:19] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#966 [13:19] <xorcon> goddam cant u just give me a mod?
#967 [13:19] <rymate1234> xorcon: for what
#968 [13:19] <xorcon> or a texture pack that mights help
#969 [13:19] <xorcon> fps
#970 [13:19] <rymate1234> search optifine
#971 [13:20] <rymate1234> :)
#972 [13:20] <xorcon> -.-
#973 [13:20] <xxDFBxx> in which forum would it be under?
#974 [13:20] <TheRandomGuy> xorcon Just go ingame options and put down the render distance, and put the graphics from fancy to fast
#975 [13:20] <xorcon> i did , its shit
#976 [13:20] <xorcon> i did
#977 [13:20] <xorcon> to lowest setttings possible
#978 [13:20] <TheRandomGuy> xxdfbxx you can search it up if you can find the search box
#979 [13:20] <xorcon> i am only getting 10 fps at best
#980 [13:20] <xorcon> so i am wondering
#981 [13:20] <xorcon> is
#982 [13:21] <xorcon> there any mods or osmething u know of witch i can try to do that might help me in this quest of futhering my fps
#983 [13:22] <xorcon> anyone....
#984 [13:22] <xorcon> ?
#985 [13:22] <xorcon> u mad bro?
#986 [13:22] <TheRandomGuy> xorcon you can always search on YouTube
#987 [13:22] <TheRandomGuy> try OptiFog
#988 [13:22] <TheRandomGuy> Thats another that is recommended
#989 [13:23] <xorcon> eh not worth it, what avs imma just quit minecraft itle there coding is good enough, but i might still play it on this other pc , witch i barley use since it my sisters
#990 [13:23] <xorcon> bye
#991 [13:23] <TheRandomGuy> bye
#992 [13:23] * Smarag [Smarag@notlogged] has joined #minecrafthelp
#993 [13:24] * wisty [wisty@notlogged] has joined #minecrafthelp
#994 [13:26] * mr_pants [mr_pants@notlogged] has joined #minecrafthelp
#995 [13:26] <mr_pants> help
#996 [13:26] * WTFWatch [WTFWatch@notlogged] has joined #minecrafthelp
#997 [13:26] <mr_pants> hello?
#998 [13:26] <mr_pants> y will noone help me?
#999 [13:29] <Guest> Optifine still did not fix the problem D:
#1000 [13:29] <Guest> Windows 7, Java 6.29, MC 1.9_5. After about 10 minutes of gameplay it freezes up, no error message or anything. Sounds continue to play until they are done (so, for example, if a song is playing it will play until the end).
#1001 [13:31] * TheReddeH [TheReddeH@notlogged] has joined #minecrafthelp
#1002 [13:31] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#1003 [13:34] * Tanjoodo [Tanjoodo@notlogged] has joined #minecrafthelp
#1004 [13:40] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#1005 [13:41] * WTFWatch [WTFWatch@notlogged] has joined #minecrafthelp
#1006 [13:42] * FireSpawn1 [FireSpawn1@notlogged] has joined #minecrafthelp
#1007 [13:43] <FireSpawn1> Could someone help me out a little?
#1008 [13:44] * pudgetta [pudgetta@notlogged] has joined #minecrafthelp
#1009 [13:44] <pudgetta> when i go to my server it says this Can't keep up! Did the system time change, or is the server overloaded?
#1010 [13:44] * onix [onix@notlogged] has joined #minecrafthelp
#1011 [13:45] <Chris> pudgetta, you can ignore that safely
#1012 [13:46] <pudgetta> but it very laggy
#1013 [13:46] <FireSpawn1> Could someone tell me why the SP client I downloaded might not be working?
#1014 [13:47] <GreyVulpine> minecraftsp.exe?
#1015 [13:47] * miharu [miharu@notlogged] has joined #minecrafthelp
#1016 [13:47] <miharu> Hello.
#1017 [13:48] <miharu> Can anyone help me out?
#1018 [13:48] <FireSpawn1> it's just called minecraft.exe, but yeah
#1019 [13:48] <GreyVulpine> FireSpawn1 - What error do you get?
#1020 [13:48] <FireSpawn1> Nothing. Nothing happens at all
#1021 [13:48] <GreyVulpine> FireSpawn1 - Do you have java installed?
#1022 [13:48] <FireSpawn1> I think so
#1023 [13:48] * FireSpawn1 is checking
#1023 [13:50] <miharu> Can anyone please help me out? My graphics driver isn't fit for Minecraft. Minecraft works if I roll back the new AMD driver I downloaded, but I can't keep it like that since I actually want to play some of my other video games that require the latest driver (Battlefield 3).
#1024 [13:50] <pudgetta> what do i do if my server very laggy
#1025 [13:50] * mib_dtxo5u [mib_dtxo5u@notlogged] has joined #minecrafthelp
#1026 [13:51] <GreyVulpine> pudgetta - What are your server's specs? Are you running the client on the same computer as your server?
#1027 [13:51] <miharu> Anyone...?
#1028 [13:51] <FireSpawn1> GreyVulpine: yeah
#1029 [13:51] <GreyVulpine> FireSpawn1 - What operating system are you on?
#1030 [13:51] <miharu> Grey, do you know anything regarding my issue, since you're the person helping here?
#1031 [13:52] <GreyVulpine> miharu - Not a fault of minecraft. It's your ATI drivers. I guess you'll have to find a driver that'll work for you
#1032 [13:52] * mib_rywvrn [mib_rywvrn@notlogged] has joined #minecrafthelp
#1033 [13:52] <miharu> Well, it kind of is Minecraft's fault for not adapting to the new drivers, but okay. I'll look around then.
#1034 [13:53] <GreyVulpine> miharu - You may have some luck if you try updating the lwjgl files with the updated drivers
#1035 [13:53] <GreyVulpine> Try http://pastebin.com/q7Vg2Jk0
#1036 [13:53] <mib_rywvrn> so i can't connect to minecraft.net and im pissed haha. help? ill also add that its been a few months since ive played so that could play into it
#1037 [13:53] <GreyVulpine> mib_rywvrn - Redownload the launcher from www.minecraft.net/download
#1038 [13:53] <mib_rywvrn> thanks dude
#1039 [13:54] <GreyVulpine> 1.8 included a new launcher. Some older launchers have been reported to not work
#1040 [13:54] <pudgetta> how do i check my server spec
#1041 [13:54] <miharu> I'll try that Grey.
#1042 [13:54] <GreyVulpine> pudgetta - What operating system are you on? How much RAM do you have on the computer?
#1043 [13:55] <pudgetta> 3gb
#1044 [13:55] <GreyVulpine> pudgetta - What operating system?
#1045 [13:55] <pudgetta> exe
#1046 [13:56] <GreyVulpine> So, windows
#1047 [13:56] <pudgetta> yea
#1048 [13:56] <GreyVulpine> Could you give me a dxdiag?
#1049 [13:56] <GreyVulpine> ??> pudgetta win/dxdiag
#1050 [13:56] <VoxelHead> pudgetta: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#1051 [13:56] <VoxelHead> pudgetta: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#1052 [13:56] <pudgetta> ok
#1053 [13:56] <GreyVulpine> Follow VoxelHead's instructions. It'll give us more information about your system
#1054 [13:57] <pudgetta> http://pastebin.com/HMW1DYjh
#1055 [13:59] <GreyVulpine> Yeah, you don't have 3 gigs of RAM, you have 2. The reason that minecraft is slow, is because the client reserves a gig of RAM for itself. The server reserves another gig. Your operating system requires RAM, and any other running programs you may have
#1056 [13:59] <GreyVulpine> Your system is choking on all those running programs, and doesn't have enough RAM
#1057 [14:00] <miharu> Grey, I've done as instructed to the letter, and the launcher goes up, I press login, black screen. The black screen remains there, the game didn't freeze, it's just black.
#1058 [14:00] <pudgetta> ohh sorry my other computer has 3
#1059 [14:00] <GreyVulpine> pudgetta - Would be good if I can get a dxdiag from there.
#1060 [14:00] <GreyVulpine> miharu - Hmm, did you replace the files in %appdata%/.minecraft/bin/ and %appdata%/.minecraft/bin/natives?
#1061 [14:00] <pudgetta> so i cant play on this computer
#1062 [14:01] <GreyVulpine> pudgetta - Not if you want to run the server and play on the same computer
#1063 [14:01] <GreyVulpine> Your computer isn't beefy enough for that
#1064 [14:01] <miharu> Yes, I've done exactly what it says I should do in the instructions, double checked.
#1065 [14:01] <pudgetta> ohh
#1066 [14:01] <pudgetta> ok
#1067 [14:01] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#1068 [14:02] <GreyVulpine> miharu - Hmm. Should've worked then. Could you check %appdata%/.minecraft/bin/natives/
#1069 [14:02] <GreyVulpine> Did you move the files from the zip folder's /native/yourOShere/ to it, or did you just move the OS folder over
#1070 [14:03] <miharu> I moved the files in the Windows folder over. And I just exited out of Minecraft and restarted it, now there's no black screen, it just freezes and my display adapter stops working for about a second like it did before.
#1071 [14:04] <GreyVulpine> Then I don't think there's anything else I can suggest for you.
#1072 [14:05] <miharu> Alright... Thanks. Maybe the 1.9 update will fix it.
#1073 [14:05] <GreyVulpine> You can revert back to the older lwjgl files by deleting the bin folder. Minecraft will redownload the files
#1074 [14:06] * Duragizer [Duragizer@notlogged] has joined #minecrafthelp
#1075 [14:08] * Jake12001200 [Jake12001200@notlogged] has joined #minecrafthelp
#1076 [14:08] * iDominateU [iDominateU@notlogged] has joined #minecrafthelp
#1077 [14:10] * bellows [bellows@notlogged] has joined #minecrafthelp
#1078 [14:10] * Contex [Contex@notlogged] has joined #minecrafthelp
#1079 [14:11] * mib_0oiay0 [mib_0oiay0@notlogged] has joined #minecrafthelp
#1080 [14:22] * itsmedamon- [itsmedamon-@notlogged] has joined #minecrafthelp
#1081 [14:29] * ferdinand [ferdinand@notlogged] has joined #minecrafthelp
#1082 [14:32] * TheBadShepperd [TheBadShepperd@notlogged] has joined #minecrafthelp
#1083 [14:33] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#1084 [14:39] * Zemedelphos [Zemedelphos@notlogged] has joined #minecrafthelp
#1085 [14:48] * CruelNoise__ [CruelNoise__@notlogged] has joined #minecrafthelp
#1086 [14:50] * mib_tgfx7x [mib_tgfx7x@notlogged] has joined #minecrafthelp
#1087 [14:50] <mib_tgfx7x> hello.
#1088 [14:50] <mib_tgfx7x> can i have help please?
#1089 [14:53] * huddler [huddler@notlogged] has joined #minecrafthelp
#1090 [14:53] * Zemedelphos [Zemedelphos@notlogged] has joined #minecrafthelp
#1091 [14:53] <huddler> helo anyone here?
#1092 [14:53] <huddler> ahhh no one again i guess i cant get any help..'
#1093 [14:54] <huddler> is anyone good with back screen
#1094 [14:54] <huddler> ask
#1095 [14:54] * Jackson413 [Jackson413@notlogged] has joined #minecrafthelp
#1096 [14:55] <huddler> is it not your joob to help ppl
#1097 [14:55] <Jackson413> any ops on?
#1098 [14:55] <huddler> im looking for some too .
#1099 [14:55] <huddler> i need help..
#1100 [14:55] <GreyVulpine> Our job? No. We're all unpaid volunteers here. Nobody gets a single cent from Mojang.
#1101 [14:55] <Jackson413> GreyVulpine, you know html right?
#1102 [14:55] <huddler> O.e
#1103 [14:55] <GreyVulpine> We all volunteer our time here to help. We might not all be here 24/7
#1104 [14:56] <huddler> omg .
#1105 [14:56] <huddler> sorry.
#1106 [14:56] <GreyVulpine> Jackson413 - Eh..
#1107 [14:56] <GreyVulpine> huddler - What operating system are you on?
#1108 [14:56] <Jackson413> im really quite good with html
#1109 [14:56] <huddler> i just need help i have black screen
#1110 [14:56] <Jackson413> but ive been trying to get something and it just wont work
#1111 [14:56] <GreyVulpine> huddler - What operating system are you on? Has it worked before?
#1112 [14:56] <huddler> windows vista.
#1113 [14:56] <huddler> ya is work before
#1114 [14:56] <GreyVulpine> huddler - Did you install any mods or texture packs?
#1115 [14:56] <Jackson413> i know for a fact its a dumb mistake, i just simply cannot see it
#1116 [14:57] <huddler> i tryed to instal a mod called builder mod .
#1117 [14:57] <GreyVulpine> huddler - That would be why.
#1118 [14:57] <huddler> but i wana play with the builder mod .
#1119 [14:57] <huddler> would i have to delet it ?
#1120 [14:57] <GreyVulpine> huddler - Go to your %appdata%/.minecraft folder. Delete everything but the saves folder. Relaunch minecraft, it'll redownload fresh files
#1121 [14:57] <huddler> delete
#1122 [14:57] <huddler> ok.
#1123 [14:57] <GreyVulpine> Jackson413 - Sorry, I haven't touched HTML in years... wouldn't be much help there
#1124 [14:58] <Jackson413> dammit
#1125 [14:58] <Jackson413> ok
#1126 [14:58] <huddler> well greyvulpine i download it all on my bin i was watching youtube video how to do it .
#1127 [14:59] <GreyVulpine> Yeah... the mod could be old, you could've followed the instructions wrong...
#1128 [14:59] <huddler> possible
#1129 [14:59] <GreyVulpine> Youtube videos aren't known to be the best resource
#1130 [14:59] <huddler> lol
#1131 [14:59] <GreyVulpine> For mods, I would recommend going to the forum post, or the actual mod creator's website
#1132 [15:00] <huddler> what do i do to delete te mod if its on my bin ?
#1133 [15:00] <GreyVulpine> You're better off there, as the mod creator would have up to date releases there
#1134 [15:00] <GreyVulpine> huddler - Just delete the bin folder entirely. Minecraft will redownload it
#1135 [15:02] * mib_czlxmx [mib_czlxmx@notlogged] has joined #minecrafthelp
#1136 [15:03] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#1137 [15:03] <huddler> this is the video i watched http://www.youtube.com/watch?v=wqfgkt3kd00
#1138 [15:03] <huddler> hello?
#1139 [15:03] <GreyVulpine> "Builders Mod 1.7.3"
#1140 [15:03] <GreyVulpine> That's your problem. Minecraft is now 1.8.1
#1141 [15:04] <GreyVulpine> Any older mods break when minecraft updates to a later version
#1142 [15:04] <huddler> ang greyvulpine i wonder how do i get the text bar to spawn stuff?
#1143 [15:04] <huddler> and./
#1144 [15:04] <huddler> oh.
#1145 [15:04] <GreyVulpine> There is no text bar in single player, you need to mod minecraft to get one
#1146 [15:04] <huddler> <.< i kinda fail at moding here lol
#1147 [15:05] <huddler> soo what do i delete in my bin.
#1148 [15:05] <huddler> ?
#1149 [15:05] <GreyVulpine> As I said before. Look for the forum post where you get minecraft mods.
#1150 [15:05] <GreyVulpine> Everything
#1151 [15:05] <huddler> so like theres nothing lefT?
#1152 [15:05] <GreyVulpine> Once you launch minecraft again, and log in. Minecraft will redownload everything
#1153 [15:05] <GreyVulpine> In /.minecraft/bin, yes
#1154 [15:05] <huddler> oh ok .
#1155 [15:06] <huddler> oh i see lol
#1156 [15:06] <GreyVulpine> http://www.minecraftforum.net/topic/105117-181-builders-064b-mob/
#1157 [15:06] <huddler> and it wont let me play online you kno why?
#1158 [15:06] <huddler> uh?
#1159 [15:06] <GreyVulpine> huddler - Why won't it?
#1160 [15:06] <huddler> brb i will check.
#1161 [15:06] <GreyVulpine> http://www.minecraftforum.net/topic/105117-181-builders-064b-mob/ -- You can find the latest builders mod here
#1162 [15:07] <huddler> it say server not fond anyways can you help me download this ?
#1163 [15:07] <huddler> cuz im not good.
#1164 [15:07] <GreyVulpine> Sorry, modding is not something I help with here.
#1165 [15:08] <GreyVulpine> huddler - Try "s.nerd.nu" for a server ip
#1166 [15:08] <GreyVulpine> You're most likely hitting servers that aren't up
#1167 [15:08] <huddler> well im going to try to download..
#1168 [15:08] <huddler> oh .
#1169 [15:08] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#1170 [15:09] <huddler> oh umm is it cuz i only have add to bin ?
#1171 [15:09] <GreyVulpine> No.
#1172 [15:10] <GreyVulpine> With mods, you generally have to open up %appdata%/.minecraft/bin/minecraft.jar in a compression program of your choice, like winrar or 7zip
#1173 [15:10] <GreyVulpine> You'll then drag the .class files from the mod into the minecraft.jar, and delete the meta-inf folder inside minecraft.jar
#1174 [15:10] * mib_9f0dzl [mib_9f0dzl@notlogged] has joined #minecrafthelp
#1175 [15:10] <GreyVulpine> Those are general installation instructions, mods may have other installation instructions as well
#1176 [15:11] * jmv12599 [jmv12599@notlogged] has joined #minecrafthelp
#1177 [15:11] * darksnake [darksnake@notlogged] has joined #minecrafthelp
#1178 [15:11] <darksnake> hello?
#1179 [15:12] <GreyVulpine> 'lo
#1180 [15:12] <darksnake> hi
#1181 [15:12] <huddler> i mean add to resources?
#1182 [15:12] <huddler> builder file is open ..
#1183 [15:12] <huddler> now i need to open appdata?
#1184 [15:12] <GreyVulpine> huddler - Yes
#1185 [15:12] <GreyVulpine> Go to .minecraft/bin/
#1186 [15:12] <jmv12599> app i scrashing after selecting a world - in browser and stand alone. i cannot copy and paste the crash message. any ideas?
#1187 [15:12] <GreyVulpine> There, you'll see minecraft.jar
#1188 [15:12] <huddler> ok
#1189 [15:12] <huddler> ok i saw that.
#1190 [15:12] <GreyVulpine> jmv12599 - Do you get any files named hs_err_pid?
#1191 [15:12] <darksnake> um this is what i says when i open up minecraft missingtex
#1192 [15:12] <GreyVulpine> huddler - Do you have a program like winrar or 7zip or a compression program?
#1193 [15:13] <darksnake> yes
#1194 [15:13] <darksnake> i have winrar
#1195 [15:13] <GreyVulpine> That wasn't directed at you darksnake
#1196 [15:13] <jmv12599> do i get those in the crash message? screen freezes cant read error message
#1197 [15:13] <GreyVulpine> jmv12599 - No, whenever minecraft crashes, you should be able to see files named hs_err_pid#### where the launcher is
#1198 [15:14] <GreyVulpine> darksnake - Could you give us exactly what minecraft says? What exactly happens?
#1199 [15:14] <jmv12599> trying...
#1200 [15:14] <darksnake> my minecraft says missingtex can you help me
#1201 [15:15] <darksnake> please
#1202 [15:15] <Thrae> darksnake: Did you install a mod or texture pack?
#1203 [15:15] <darksnake> no
#1204 [15:15] <jmv12599> black screen, error message flashes, sometimes i can see first part of error message. i cannot select text from error to copy and paste
#1205 [15:15] <darksnake> and no what to do for that you click force uptade
#1206 [15:15] <darksnake> Minecraft has crashed! ---------------------- Minecraft has stopped running because it encountered a problem. If you wish to report this, please copy this entire text and email it to support@mojang.com. Please include a description of what you did when the error occured. --- BEGIN ERROR REPORT a1dce528 -------- Generated 05/11/11 1:07
#1207 [15:16] <Thrae> darksnake: Post the error report to www.pastebin.com and give us the link. And yes, try Force Update.
#1208 [15:16] <darksnake> it says missingtex
#1209 [15:16] <darksnake> i did force update 5 time!
#1210 [15:16] <huddler> greyvulpin i just opened minecraft.jar now what?
#1211 [15:16] <huddler> greyvulpie
#1212 [15:16] <Thrae> darksnake: If Force Update doesn't work we'll need the entire error report posted to www.pastebin.com and the link to what you just posted.
#1213 [15:16] <huddler> ...
#1214 [15:17] <darksnake> ok
#1215 [15:17] <Thrae> ?? patience
#1216 [15:17] <VoxelHead> patience: Please be patient when waiting for a response. Many of the helpers here are helping in their free time at school or work, and often get called away.
#1217 [15:17] <huddler> greyvulpine
#1218 [15:17] <VoxelHead> patience: In short, your supplications will be answered, in the order in which they are received. See also ?? attitude.
#1219 [15:17] <GreyVulpine> huddler - You'll then drag the mod's files into minecraft.jar
#1220 [15:17] <GreyVulpine> huddler - Delete the meta-inf folder inside minecraft.jar, and that should be it
#1221 [15:17] <huddler> like what tmod theses mods?
#1222 [15:17] <Thrae> jmv12599: Are you on Windows?
#1223 [15:17] <huddler> i did delete it .
#1224 [15:17] <GreyVulpine> huddler - Huh?
#1225 [15:18] <huddler> nvm what i sayed.
#1226 [15:18] <jmv12599> yes win xp
#1227 [15:18] <huddler> i did delete it .
#1228 [15:18] * guest-860941-29069 [guest-860941-29069@notlogged] has joined #minecrafthelp
#1229 [15:18] <GreyVulpine> huddler - Did you move the mod's .class files into minecraft.jar?
#1230 [15:18] <darksnake> i went to pastebin.con
#1231 [15:18] <darksnake> com
#1232 [15:18] <darksnake> no what?
#1233 [15:18] <huddler> i dont know what you mean ?
#1234 [15:18] <darksnake> now what?
#1235 [15:18] <huddler> just the builder files?
#1236 [15:18] <Thrae> jmv12599: Download and place this batch file in the same location as Minecraft.exe , then run the batch file to launch Minecraft -- http://www.matts-hosting.com/~thrae/minecraft/fix/DiagnoseMinecraft.bat
#1237 [15:18] <GreyVulpine> huddler - You see minecraft.jar, yes? Did you open it up in winrar/7zip?
#1238 [15:19] <darksnake> no me/
#1239 [15:19] <huddler> yes
#1240 [15:19] <darksnake> ?
#1241 [15:19] <Thrae> darksnake: Copy and paste the error report to Pastebin, then give us the link to what you just submitted.
#1242 [15:19] <GreyVulpine> huddler - You'll then copy the mod's files over into minecraft.jar, delete the meta-inf folder, and close winrar/7zip
#1243 [15:19] <darksnake> what?
#1244 [15:19] <GreyVulpine> That should be all you need to do to install buildercraft
#1245 [15:19] <jmv12599> thx trying...
#1246 [15:19] <darksnake> hold on please
#1247 [15:20] <huddler> there i did it now what ?
#1248 [15:20] <GreyVulpine> huddler - Run minecraft
#1249 [15:20] * mib_9zl759 [mib_9zl759@notlogged] has joined #minecrafthelp
#1250 [15:20] <huddler> ok brb
#1251 [15:20] <mib_9zl759> hello
#1252 [15:20] <mib_9zl759> uh
#1253 [15:21] <Thrae> mib_9zl759: Greetings. If you have a problem, please tell us.
#1254 [15:21] <Sardonicus> Your face :D
#1255 [15:22] <rymate1234> !check server.rymatemc.info
#1256 [15:22] <mib_9zl759> ive payed for minecraft and ive downloaded it onto my desktop
#1257 [15:22] <rymate1234> yay ^_^
#1258 [15:22] <huddler> greyvulpine i run minecraft but there is no dude do i have to be in survival mode or free build?
#1259 [15:22] <darksnake> it says still missingtex
#1260 [15:22] <GreyVulpine> huddler - Huh?
#1261 [15:23] * guest-860941-11944 [guest-860941-11944@notlogged] has joined #minecrafthelp
#1262 [15:23] <huddler> i open minecraft but the mod is not working...
#1263 [15:23] <Thrae> darksnake: I told you to copy the full error report to www.pastebin.com and give us the URL in your address bar after you hit submit.
#1264 [15:23] * AndrewsPanda2 [AndrewsPanda2@notlogged] has joined #minecrafthelp
#1265 [15:23] <darksnake> it says missingtex no mojang
#1266 [15:23] <darksnake> ok
#1267 [15:23] <huddler> i duno how to mkae minecraft dudes.
#1268 [15:23] <huddler> make.
#1269 [15:24] <GreyVulpine> I do not know what you mean by "Minecraft dudes"
#1270 [15:24] <huddler> like minecraft miners and woodsmen
#1271 [15:24] <huddler> the dudes that come with the mod <.<
#1272 [15:24] <huddler> that build for yo u..
#1273 [15:24] <huddler> you
#1274 [15:24] <GreyVulpine> No idea. I don't use the mod.
#1275 [15:25] <GreyVulpine> Read the forum post, you may get a better idea. http://www.minecraftforum.net/topic/105117-181-builders-064b-mob/
#1276 [15:25] <darksnake> here is the url http://pastebin.com/zsvyEXTU
#1277 [15:25] <huddler> ok.
#1278 [15:25] * koulchilebaiz [koulchilebaiz@notlogged] has joined #minecrafthelp
#1279 [15:25] <mib_9zl759> ive payed for minecraft and ive downloaded it onto my desktop and when i click on it it says run or cancel, i click run and when it comes up with the mine craft launcher i type my correct password and username and click log in and it quits minecraft launcher , DOESN'T bring up mine craft and leaves a thing in the desktop which looks like a notebook
#1280 [15:25] <mib_9zl759> can you help me please?
#1281 [15:26] <mib_9zl759> PLEASE
#1282 [15:26] <Thrae> mib_9zl759: Open up the thing on your desktop that "looks like a notebook", copy the entire contents using Edit->Select All then Edit->Copy, then paste it to www.pastebin.com and give us the link.
#1283 [15:26] <GreyVulpine> mib_9zl759 - Please copy the contents of that file that minecraft leaves on your desktop, paste it at www.pastebin.com and give us the URL
#1284 [15:26] <darksnake> hold on wait your turn
#1285 [15:26] <GreyVulpine> Bleh, ninja's
#1286 [15:26] <GreyVulpine> d
#1287 [15:26] <huddler> greyvulpine i read it the dudes are called mobs
#1288 [15:26] <Thrae> darksnake: Hmm how much free space does your C: drive have?
#1289 [15:27] <GreyVulpine> huddler - again, I don't help with mods, There's hundreds of different mods out there, I can't possibly be arsed to know them all
#1290 [15:27] <darksnake> my computer?
#1291 [15:27] <mib_9zl759> so i give you what it says on the notepad?
#1292 [15:27] <Thrae> darksnake: Yes. If you have more than one drive, just C:
#1293 [15:27] <GreyVulpine> mib_9zl759 - Yes, copy it onto pastebin.com and give us the URL
#1294 [15:27] <mib_9zl759> yep just a sec
#1295 [15:27] * mib_7bc9zt [mib_7bc9zt@notlogged] has joined #minecrafthelp
#1296 [15:27] <huddler> well ok thanks for the help anyways :( i will just leave my game were it is ..
#1297 [15:27] <darksnake> 29.8 gb free
#1298 [15:27] <huddler> bye.
#1299 [15:28] <mib_9zl759> #
#1300 [15:28] <darksnake> :(
#1301 [15:28] <Thrae> darksnake: OK, try selecting Start->Run (or Windows Key + R) and typing in %APPDATA%\.minecraft , and delete everything there except "saves".
#1302 [15:29] * Tyro [Tyro@notlogged] has joined #minecrafthelp
#1303 [15:29] <jmv12599> placed the .bat file in same directory ast minecraft.exe and came back with error that it could not find the .exe file - will try again....
#1304 [15:29] * guest-860941-45616 [guest-860941-45616@notlogged] has joined #minecrafthelp
#1305 [15:29] <Thrae> jmv12599: Is it named "Minecraft.exe" and not something like "Minecraft (1).exe"?
#1306 [15:29] <darksnake> ok done
#1307 [15:29] <darksnake> :(
#1308 [15:29] <Thrae> darksnake: OK, run Minecraft and it should re-download.
#1309 [15:30] * Umlaut [Umlaut@notlogged] has joined #minecrafthelp
#1310 [15:30] <jmv12599> yes minecraft.exe
#1311 [15:30] <mib_9zl759> GRAPE VULPINE I CANT COPY PASTE ALL OF IT BUT THIS IS THE FIRST LINE
#1312 [15:30] <darksnake> ok
#1313 [15:30] <jmv12599> came back "file not found"
#1314 [15:30] <GreyVulpine> mib_9zl759 - Sure you can. Open up the file, go to Edit -> Select all. Then Edit -> copy
#1315 [15:30] <jmv12599> does the .exe file need to be located in the .minecraft directory?
#1316 [15:30] <GreyVulpine> Go to http://www.pastebin.com and do Edit -> paste in the text box
#1317 [15:30] <Thrae> jmv12599: Nope
#1318 [15:30] <GreyVulpine> jmv12599 - No
#1319 [15:31] <darksnake> it still says missingtex
#1320 [15:31] <mib_9zl759> # A fatal error has been detected by the java runtime enviroment
#1321 [15:31] <darksnake> :/
#1322 [15:31] <Thrae> darksnake: Same error report?
#1323 [15:31] <darksnake> :0
#1324 [15:31] <darksnake> :o
#1325 [15:31] <GreyVulpine> mib_9zl759 - I need the full error message. That tells me nothing other than your minecraft has a problem
#1326 [15:31] <darksnake> yes
#1327 [15:31] <Tyro> ok i tried to buy the game but it didnt accept my credit card or debit card, it didnt work so many times that now i have to wait 24 hours to try again. so i tried playing the free version and i got an error message right away
#1328 [15:31] <GreyVulpine> mib_9zl759 - Please paste the entire error message at pastebin.com and give us the address
#1329 [15:32] <Tyro> any ideas?
#1330 [15:32] <Thrae> darksnake: Please stop spamming emoticons.
#1331 [15:32] <mib_9zl759> greyvulpine that is firs line
#1332 [15:32] <darksnake> ok
#1333 [15:32] <GreyVulpine> mib_9zl759 - I need the full error message. That tells me nothing other than your minecraft has a problem
#1334 [15:32] <GreyVulpine> mib_9zl759 - Please paste the entire error message at pastebin.com and give us the address
#1335 [15:32] <mib_9zl759> ok wait is that a website or something
#1336 [15:32] <mib_9zl759> ?
#1337 [15:32] <Thrae> Tyro: You mean Minecraft Classic?
#1338 [15:32] <GreyVulpine> Yes. http://www.pastebin.com
#1339 [15:33] <mib_9zl759> thanks BRB
#1340 [15:33] <Umlaut> Is there anyone that can point me in the right direction to recover my account? My email account that I registered with was deleted by google and minecraft support has not returned my emails.
#1341 [15:33] <jmv12599> for what its worth minecraft crashes in the same manner if i play it thru the web
#1342 [15:33] <darksnake> same here
#1343 [15:33] * craftman_6000 [craftman_6000@notlogged] has joined #minecrafthelp
#1344 [15:33] <GreyVulpine> Umlaut - Will PM you an email to contact
#1345 [15:34] <craftman_6000> can i play minecraft on different computers without having to pay again
#1346 [15:34] <GreyVulpine> craftman_6000 - Yes
#1347 [15:34] <GreyVulpine> Minecraft is not locked onto the PC you paid on, you can install minecraft on any computer you have access to
#1348 [15:35] <darksnake> um my minecraft still says missingtex
#1349 [15:35] <craftman_6000> thank you i've been wondering for ever
#1350 [15:35] <Thrae> darksnake: OK, go to Programs and Features and uninstall all copies of Java found. Then go to Control Panel, Java Control Panel, click on Settings under "Temporary Internet Files", then click on "Delete Files". Install Java 32-bit (x86) and 64-bit (x64) from WugBot's link --
#1351 [15:35] <Thrae> :j
#1352 [15:35] <WugBot> j: Current Recommended Java Version: http://goo.gl/h2OEh (Java SE Runtime Environment 6 Update 29)
#1353 [15:36] <darksnake> how do i get to programes?
#1354 [15:36] <craftman_6000> also does minecraft let any viruses onto my computer
#1355 [15:36] <Thrae> darksnake: Control Panel
#1356 [15:36] <GreyVulpine> craftman_6000 - No
#1357 [15:36] <darksnake> ok
#1358 [15:36] <mib_9zl759> http://pastebin.com/q41mR4He
#1359 [15:36] <craftman_6000> thank u so muuch
#1360 [15:36] * timeimp [timeimp@notlogged] has joined #minecrafthelp
#1361 [15:36] <mib_9zl759> grey vulpine there it is
#1362 [15:36] * mib_dwwrw2 [mib_dwwrw2@notlogged] has joined #minecrafthelp
#1363 [15:37] <Tyro> An error occured while loading the applet. Please contact support to resolve this issue. Fatal error occured (4): unable to get input stream for lwjgl_applet.jar.pack
#1364 [15:38] <darksnake> might take some time
#1365 [15:38] <GreyVulpine> Tyro - That's either java (uninstall/reinstall java), or your security software blocking java from downloading files
#1366 [15:38] <mib_9zl759> so what do i do
#1367 [15:38] <Tyro> ok thanks ill try to work on it
#1368 [15:38] <mib_9zl759> ?
#1369 [15:38] <Thrae> mib_9zl759: Update your Java from this link -- http://goo.gl/h2OEh (download x86 offline)
#1370 [15:38] <darksnake> my computer is 64-bit
#1371 [15:39] <Thrae> darksnake: Yes, that's why I told you to download both 32-bit and 64-bit
#1372 [15:39] <mib_9zl759> do i click on it THRAE
#1373 [15:39] <Thrae> mib_9zl759: Yes, that's why I gave you the link...
#1374 [15:40] * lildrummerdrew [lildrummerdrew@notlogged] has joined #minecrafthelp
#1375 [15:40] * craftman_6000 [craftman_6000@notlogged] has joined #minecrafthelp
#1376 [15:40] <lildrummerdrew> Hrm, I wonder who's here that can help me.
#1377 [15:40] <lildrummerdrew> ??< index
#1378 [15:40] * violoncello [violoncello@notlogged] has joined #minecrafthelp
#1379 [15:41] <darksnake> when i say uninstall java it says errour
#1380 [15:41] <Thrae> lildrummerdrew: We need to know what's wrong before we can help.
#1381 [15:41] <Thrae> darksnake: That's all it says? Just "error"?
#1382 [15:41] <lildrummerdrew> Thrae: I've been here before, I need to know the helper, because my problem is helper-dependant, most likely.
#1383 [15:41] <darksnake> yes
#1384 [15:41] <mib_9zl759> WHICH DOWNLOAD DO I DO?
#1385 [15:41] <craftman_6000> can i play minecraft onn a different computer without having to pay again
#1386 [15:41] <GreyVulpine> <+Thrae> mib_9zl759: Update your Java from this link -- http://goo.gl/h2OEh (download x86 offline)
#1387 [15:41] <violoncello> anyone else having connection problems this morning?
#1388 [15:41] <darksnake> and all of my java files say corupdated
#1389 [15:41] <GreyVulpine> craftman_6000 - Yes
#1390 [15:42] <GreyVulpine> violoncello - Can't say I have heard of any recent issues..
#1391 [15:42] <lildrummerdrew> Here's something to look at. I used the newer "DiagnoseMinecraft" batch and got this: http://pastebin.com/2AWRruhz
#1392 [15:42] <lildrummerdrew> I can tell you the issue, too.
#1393 [15:42] <lildrummerdrew> My internet connectivity is somewhat blocked.
#1394 [15:43] <GreyVulpine> lildrummerdrew - 20 bucks says it's a filtering software, like parental controls
#1395 [15:43] <Thrae> darksnake: Sounds like Java is corrupt. Does it still uninstall?
#1396 [15:43] <darksnake> no
#1397 [15:43] <GreyVulpine> or firewall
#1398 [15:43] <lildrummerdrew> I even tried to join 2 servers, but I can't without running the program as admin. And grey, it is.
#1399 [15:43] <lildrummerdrew> I know that.
#1400 [15:43] <violoncello> GreyV - hm. Thanks. I'm getting the "can't connect to minecraft.net" message, but offline is working fine. I just got the 1.8 upgrade
#1401 [15:43] <GreyVulpine> violoncello - Did you pay for minecraft?
#1402 [15:43] <Thrae> lildrummerdrew: You mean my experimental batch file, or the one officially hosted?
#1403 [15:44] <lildrummerdrew> GreyVulpine, I'm looking for a solution, because when I run it normally, texture packs and servers don't show up...
#1404 [15:44] <darksnake> :(
#1405 [15:44] <lildrummerdrew> Thrae, unsure.
#1406 [15:44] <violoncello> GreyV, yes.
#1407 [15:44] <lildrummerdrew> GreyVulpine, also, when running the batch, the servers/packs DO show up.
#1408 [15:44] <GreyVulpine> violoncello - What operating system are you on?
#1409 [15:44] * Havanacus [Havanacus@notlogged] has joined #minecrafthelp
#1410 [15:44] <violoncello> GreyV - Mac
#1411 [15:45] <Thrae> darksnake: Alright, this should be able to help you -- http://support.microsoft.com/mats/Program_Install_and_Uninstall
#1412 [15:45] <darksnake> ok brb
#1413 [15:45] <GreyVulpine> violoncello - Generally on macs, it's caused by either the system time/date being off, or some sort of security software blocking minecraft from connecting to login.minecraft.net
#1414 [15:45] <GreyVulpine> login.minecraft.net is up for me.
#1415 [15:45] * koulchilebaiz_ [koulchilebaiz_@notlogged] has joined #minecrafthelp
#1416 [15:45] <lildrummerdrew> Same here ^^
#1417 [15:45] <lildrummerdrew> Grey, any ideas as to fixing my problem?
#1418 [15:46] <GreyVulpine> lildrummerdrew - Turn off parental controls?
#1419 [15:46] <darksnake> it says C:\Users\Matthew\AppData\Local\Temp could not be saved, because an unknown error occurred. Try saving to a different location.
#1420 [15:46] <lildrummerdrew> Not a solution.
#1421 [15:46] <lildrummerdrew> And I'm saying is this:
#1422 [15:46] <GreyVulpine> lildrummerdrew - Then no, I do not know.
#1423 [15:46] <lildrummerdrew> When I "run as administrator", texture packs and servers don't show up in the lists. this means internet isn't the problem, but...
#1424 [15:47] <violoncello> GreyV - It was working not too long ago; not sure what's changed on my end, but I can look into systime stuff.
#1425 [15:47] <lildrummerdrew> When I ran the batch, (ignoring the internet problems,) I couldn't find any issues.
#1426 [15:47] <violoncello> No change to sec software either.
#1427 [15:47] <darksnake> nevermind i downloaded fix it
#1428 [15:47] * mr_sticky [mr_sticky@notlogged] has joined #minecrafthelp
#1429 [15:48] <Thrae> lildrummerdrew: Hold down SHIFT then right-click on the batch file -- this should give you "Run as Administrator" option. See if the output changes.
#1430 [15:48] * mib_xutll5 [mib_xutll5@notlogged] has joined #minecrafthelp
#1431 [15:48] <lildrummerdrew> Thrae, shift not needed, but I'll run as admin, sure.
#1432 [15:48] <mr_sticky> is greyvulpine online
#1433 [15:48] * umbridge [umbridge@notlogged] has joined #minecrafthelp
#1434 [15:48] <mr_sticky> hello
#1435 [15:48] <GreyVulpine> Yes?
#1436 [15:48] <GreyVulpine> Hi
#1437 [15:48] <lildrummerdrew> Didn't know if doing that would affect how mc started or not.
#1438 [15:48] <umbridge> k
#1439 [15:48] <GreyVulpine> mr_sticky - Did you need something?
#1440 [15:49] <umbridge> hey guys
#1441 [15:49] <GreyVulpine> mr_sticky - Hello?
#1442 [15:49] <umbridge> i asking u if u can help me...
#1443 [15:49] <violoncello> GreyV - Ah! i'm getting no response from login.minecraft.net
#1444 [15:49] <darksnake> fix it is not working
#1445 [15:49] <GreyVulpine> umbridge - Yes, with?
#1446 [15:49] <lildrummerdrew> Thrae: This made it start from another location, thus making the minecraft.exe not in there, and it couldn't download it from minecraft.net
#1447 [15:49] <umbridge> i can join my own server minecraft but no one can't enter in
#1448 [15:49] <umbridge> why?
#1449 [15:49] <darksnake> never mind
#1450 [15:49] <mr_sticky> uh i downloaded 84 offline it still doing same the greyvulpine
#1451 [15:49] <lildrummerdrew> umbridge, port forwarding.
#1452 [15:49] <GreyVulpine> umbridge - Most likely, you're running this on a home connection and will need to port forward your router
#1453 [15:49] * itsmedamon- [itsmedamon-@notlogged] has joined #minecrafthelp
#1454 [15:49] <GreyVulpine> mr_sticky - Did you install it?
#1455 [15:50] * inv0lt [inv0lt@notlogged] has joined #minecrafthelp
#1456 [15:50] <inv0lt> lol
#1457 [15:50] <mr_sticky> i think so
#1458 [15:50] <lildrummerdrew> ;p
#1459 [15:50] <GreyVulpine> mr_sticky - Make sure?
#1460 [15:50] <GreyVulpine> mr_sticky - Downloading a file off the internet doesn't necessarily install it for you
#1461 [15:50] <umbridge> how do you want that i do this?
#1462 [15:50] <mr_sticky> do i need to do it again greyvulpine
#1463 [15:50] <GreyVulpine> You need to run the file for it to install
#1464 [15:50] <umbridge> port foward router lol
#1465 [15:50] <umbridge> port foward router lol
#1466 [15:50] * inv0lt [inv0lt@notlogged] has left #minecrafthelp
#1467 [15:50] <GreyVulpine> mr_sticky - I'd recommend uninstalling java, and running the install file again
#1468 [15:50] <lildrummerdrew> Ah well, maybe I'll just play without a texture pack...
#1469 [15:51] <darksnake> it says failed to install micrsoft fixit "(
#1470 [15:51] <darksnake> :(
#1471 [15:51] <mr_sticky> ok but what was the address greyvulpine
#1472 [15:51] <violoncello> GreyV - browser times out, pings time out, etc. nslookup works, though. But this could be the time/date issue? know of any documentation on a fix/workaround?
#1473 [15:51] <GreyVulpine> mr_sticky - For.. java?
#1474 [15:51] <mr_sticky> yes
#1475 [15:51] <GreyVulpine> :j
#1476 [15:51] <WugBot> j: Current Recommended Java Version: http://goo.gl/h2OEh (Java SE Runtime Environment 6 Update 29)
#1477 [15:51] <GreyVulpine> violoncello - nslookup returns what ip address for login.minecraft.net?
#1478 [15:51] <umbridge> greyvulpine, how can i do ``port foward router``
#1479 [15:52] <Thrae> darksnake: I'm pretty sure your Windows installation is corrupt and will need to be reinstalled.
#1480 [15:52] <mr_sticky> thanks it makes me quit so i might come back as a different name
#1481 [15:52] <darksnake> sorry what?
#1482 [15:52] <GreyVulpine> umbridge - All depends on what router you have. There's hundreds of manufacturer's out there, and thousands of different models
#1483 [15:52] <Thrae> umbridge: http://portforward.com/english/applications/port_forwarding/Minecraft_Server/Minecraft_Serverindex.htm
#1484 [15:52] <darksnake> like recovery dick?
#1485 [15:52] <darksnake> disck?
#1486 [15:52] <violoncello> GreyVulpine - 184.73.238.42
#1487 [15:53] <violoncello> an amazon host
#1488 [15:53] <darksnake> oops wrong word
#1489 [15:53] <Thrae> darksnake: You either have a hardware problem with your hard drive or Windows itself is bad and will need to be reinstalled. Yes, you can use a recovery disk to reinstall Windows. Right now it can't use TEMP files and that will make a LOT of programs not work right.
#1490 [15:53] <GreyVulpine> violoncello - That should be right then.
#1491 [15:53] <Thrae> darksnake: I suggest contacting your computer manufacturer.
#1492 [15:53] <darksnake> recovery disck
#1493 [15:53] <GreyVulpine> violoncello - I'd look into your security software, if you have any installed.
#1494 [15:54] <darksnake> ok ill do that
#1495 [15:54] <Thrae> ??> violoncello mac/hosts
#1496 [15:54] <VoxelHead> violoncello: (mac/hosts) You may have a problem with your hosts file, which overrides DNS queries. Please follow the following directions:
#1497 [15:54] <VoxelHead> violoncello: (mac/hosts) From the finder toolbar, search for the following item: "/private/etc/hosts". Open that file in the text editor, and copy the contents onto Pastebin, and give us the resulting URL.
#1498 [15:55] <Thrae> violoncello: Just in case, let's double-check your hosts file
#1499 [15:55] <violoncello> Thrae - double checking; i'm pretty sure it's empty
#1500 [15:55] <Thrae> violoncello: Yeah if it's empty don't bother pastebin'ing it
#1501 [15:56] <umbridge> you sure that pfconfi things.. is safe?
#1502 [15:56] * shmoo [shmoo@notlogged] has joined #minecrafthelp
#1503 [15:57] <shmoo> GREYVULPER
#1504 [15:57] <GreyVulpine> Don't download pfconfig. There should be an option in the upper right to skip that ad
#1505 [15:57] <GreyVulpine> shmoo - Yes?
#1506 [15:57] <violoncello> Threa, yeah. It's empty (or commented out old entries).
#1507 [15:57] <umbridge> k i already downloadd it
#1508 [15:57] * amphibulus [amphibulus@notlogged] has joined #minecrafthelp
#1509 [15:58] <violoncello> Thea, GreyVulpine - know of any documentation on this time/date issue?
#1510 [15:58] <GreyVulpine> umbridge - Okay, did you uninstall java from your system before running that file?
#1511 [15:58] <umbridge> but what i need to do?
#1512 [15:58] <Thrae> umbridge: I sent you to that page just for instructions
#1513 [15:58] <umbridge> k
#1514 [15:58] <GreyVulpine> violoncello - Documentation? No. The minecraft laucher uses SSL over HTTPS to authenticate. SSL authentication requires a valid time and date on the cert.
#1515 [15:58] * froglegstew [froglegstew@notlogged] has joined #minecrafthelp
#1516 [15:58] <shmoo> hello greyvulpine i downloadded it installed it and it still comes u[p with the notebook
#1517 [15:59] * JNSK [JNSK@notlogged] has joined #minecrafthelp
#1518 [15:59] <Thrae> umbridge: That page has instructions on port forwarding for different router brands and models. Physically find your router's brand and model and look at its instructions.
#1519 [15:59] <JNSK> hello
#1520 [15:59] <GreyVulpine> shmoo - Could you give us a dxdiag?
#1521 [15:59] <GreyVulpine> ??> shmoo win/dxdiag
#1522 [15:59] <VoxelHead> shmoo: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#1523 [15:59] <Thrae> JNSK: Yes?
#1524 [15:59] <VoxelHead> shmoo: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#1525 [15:59] <violoncello> GreyVulpine - i don't get a cert error when i request login.minecraft.net… just empty response
#1526 [16:00] <shmoo> what is dxdiag
#1527 [16:00] <shmoo> ?
#1528 [16:00] <GreyVulpine> violoncello - Hmm, I think the website has been changed recently, used to return a page
#1529 [16:00] <Thrae> <shmoo> what is dxdiag <-- read VoxelHead's instructions
#1530 [16:00] <JNSK> i expected some terrible lagg on the server i used to play
#1531 [16:00] <shmoo> yep got it but what is the ''win'' button
#1532 [16:00] <Thrae> ??> shmoo win/key
#1533 [16:00] <VoxelHead> shmoo: (win/key) Hold down the Windows key (between Control and Alt, usually to the left of the space bar), and then press the other specified key. Think of it as typing a capital letter, but using that key instead of Shift.
#1534 [16:01] * Xiphos [Xiphos@notlogged] has joined #minecrafthelp
#1535 [16:01] <shmoo> ok thanks
#1536 [16:01] <Thrae> GreyVulpine , violoncello : Yeah, I'm not getting a response from login.minecraft.net either
#1537 [16:01] <GreyVulpine> Bleh, well then.
#1538 [16:02] <Thrae> http://session.minecraft.net/ gives me a blank page
#1539 [16:02] * mib_uo7sby [mib_uo7sby@notlogged] has joined #minecrafthelp
#1540 [16:02] <Xiphos> hey guys, i was wondering if any of you can help me...i want to install the YogBox, if i do the "force update" method of installing it, will anything happen to the multiplayer server i host?
#1541 [16:02] <GreyVulpine> Nope. The client and server are two seperate entities
#1542 [16:02] <Thrae> Xiphos: We generally don't help with mods here, but no
#1543 [16:02] <shmoo> its taking awhile to load
#1544 [16:02] <Xiphos> sorry Thrae, and thanks GreyVulpine
#1545 [16:03] <Thrae> violoncello: Did you try http://www.minecraft.net/play ?
#1546 [16:03] <violoncello> Threa GreyVulpine - yeah, just saw this in my console, too: io exceptions (FNF) on http://session.minecraft.net/game/getversion.jsp?
#1547 [16:03] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#1548 [16:04] <mib_uo7sby> Hello. i see what you had written here about mods but i have an urgent question. I am looking for a mod that allows me to put the camera outside my character (static camera. not cctv mod ) and record as he moves . is anything like this exists?
#1549 [16:04] * Blackthorne [Blackthorne@notlogged] has joined #minecrafthelp
#1550 [16:04] <GreyVulpine> mib_uo7sby - Press F5?
#1551 [16:04] <violoncello> Threa - oh ho! I'm getting cert errors on the applet, from mc.net/play
#1552 [16:04] <mib_uo7sby> not F5
#1553 [16:05] <GreyVulpine> Minecraft pre5, 1.9 has camera controls I believe
#1554 [16:05] <GreyVulpine> Was accidently left in.
#1555 [16:05] <mib_uo7sby> yes i tried it but it's not the same.
#1556 [16:05] <mib_uo7sby> i really liked zoom and rotate
#1557 [16:05] <GreyVulpine> That's the extent of my knowledge.
#1558 [16:05] <mib_uo7sby> hmm okay then.
#1559 [16:05] <mib_uo7sby> hmm okay then.
#1560 [16:05] * Umlaut [Umlaut@notlogged] has left #minecrafthelp
#1561 [16:06] <Thrae> violoncello: Not sure, maybe they closed some access to the site as I can login to Minecraft fine and play on my own auth-required server
#1562 [16:06] * mib_nqvrdz [mib_nqvrdz@notlogged] has joined #minecrafthelp
#1563 [16:06] * TheNytangel` [TheNytangel`@notlogged] has joined #minecrafthelp
#1564 [16:07] <Thrae> violoncello: Lemme try something
#1565 [16:07] <violoncello> Threa - but then wouldn't everyone be seeing my issue?
#1566 [16:07] <violoncello> Threa - I mean, if something had been shut down site access-wise
#1567 [16:08] <shmoo> greyvulpinethis is the address http://pastebin.com/0yQYt2QG
#1568 [16:08] <Thrae> violoncello: I'm saying it may just be for security reasons that only Minecraft itself can access these parts of the site (login.minecraft.net and session.minecraft.net), one sec
#1569 [16:08] <shmoo> greyvulpine
#1570 [16:08] <shmoo> http://pastebin.com/0yQYt2QG
#1571 [16:08] <GreyVulpine> I saw the link the first time, one sec
#1572 [16:09] <GreyVulpine> Really do not think your "SiS 661FX/GX Mirage Graphics" on that computer will handle minecraft
#1573 [16:10] <shmoo> me ,shmoo
#1574 [16:10] <shmoo> no graphics
#1575 [16:10] <Thrae> shmoo: Yeah, that's not even a video card
#1576 [16:10] <Thrae> violoncello: Hmm try removing the Certificate in the Java Control Panel
#1577 [16:11] <Thrae> violoncello: https://elearn.usu.edu/java/clearing-certificates.html , might as well clear the cache too
#1578 [16:11] <shmoo> so i just wasted 30 dollars
#1579 [16:11] <shmoo> for nothing
#1580 [16:11] <shmoo> for notthing
#1581 [16:11] <violoncello> Threa - for the web version?
#1582 [16:12] <Thrae> violoncello: For both the web version and launcher. That's where Java stores its certificates.
#1583 [16:12] <violoncello> Threa - Thanks, checking.
#1584 [16:12] <mib_nqvrdz> hello.earlier i was asking about camera mod (not cctv) and now i found the answer. The mod i was looking for is Minecraft Zombe Mod Pack
#1585 [16:12] <mib_nqvrdz> have a good day
#1586 [16:13] <violoncello> Threa - interesting: there are no minecraft/notch related certs at all, in there
#1587 [16:13] * mib_x34fg9 [mib_x34fg9@notlogged] has joined #minecrafthelp
#1588 [16:13] <violoncello> Threa - i.e., nothing to clear.
#1589 [16:13] <shmoo> GREYVULPINE
#1590 [16:13] * mib_j281wm [mib_j281wm@notlogged] has joined #minecrafthelp
#1591 [16:14] <shmoo> will i no be able to play minecraft
#1592 [16:14] <shmoo> GREYVULPINE
#1593 [16:14] <lildrummerdrew> hm.
#1594 [16:14] <lildrummerdrew> GreyVulpine, I figured the problem. Shmoo, caps please.
#1595 [16:14] <shmoo> what
#1596 [16:14] <shmoo> ?
#1597 [16:14] <shmoo> ?
#1598 [16:15] <lildrummerdrew> Please do not use all capital letters.
#1599 [16:15] <Thrae> shmoo: There's nothing anybody can do. Your computer is simply too old to play modern games.
#1600 [16:15] <umbridge> k thanks .. but know i don't really know what do know even if i have the instruction
#1601 [16:15] <umbridge> what do do
#1602 [16:15] <lildrummerdrew> And GreyVulpine, when ran as an administrator, it uses the administrator's profile... Meaning it uses their texture packs, their remembered logins, their servers... ;p
#1603 [16:15] <Thrae> shmoo: You can either look into upgrading it, like adding in a video card, or buying a cheap new computer with a video card.
#1604 [16:15] <shmoo> so i wasted 30$ for nothing Thrae
#1605 [16:16] <Thrae> violoncello: Not sure what's going on...here on Windows I cleared out my SSL certs and my Java certs and I'm still logging into Minecraft fine.
#1606 [16:16] <lildrummerdrew> Thrae, please relay my message to GreyVulpine, tell him to check the logs, or even use pastebin if you must, but I must be off.
#1607 [16:17] * TheNytangel` [TheNytangel`@notlogged] has joined #minecrafthelp
#1608 [16:17] <lildrummerdrew> Farewell.
#1609 [16:17] <Thrae> umbridge: Those instructions are pretty specific and have pictures.
#1610 [16:17] <umbridge> i am at the end of the instruction but
#1611 [16:18] <umbridge> yea i know i am doing what i am supposly to do but only at the end it does not work
#1612 [16:18] <umbridge> ..
#1613 [16:18] <shmoo> 30 Bloody dollars
#1614 [16:18] <violoncello> Threa - I think the FileNotFound exception I'm seeing in the Console is key here. The launcher is trying to call out to session.minecraft.net/game/getversion.jsp and can't find it
#1615 [16:18] * clarjon1 [clarjon1@notlogged] has joined #minecrafthelp
#1616 [16:18] <shmoo> how much do video cards cost
#1617 [16:18] <shmoo> how much
#1618 [16:18] <shmoo> HOW MUCH!
#1619 [16:19] <shmoo> bye
#1620 [16:19] <shmoo> n
#1621 [16:19] <shmoo> bhjb ubjb nkj mmgtrwaqh,k;mij
#1622 [16:19] <violoncello> Threa - maybe i'll manually re-download the launcher. Maybe something's moved.
#1623 [16:19] <Thrae> violoncello: What IP do you get for session.minecraft.net?
#1624 [16:20] <violoncello> 404
#1625 [16:21] <violoncello> ^ Threa
#1626 [16:22] * TheNytangel_ [TheNytangel_@notlogged] has joined #minecrafthelp
#1627 [16:23] <Thrae> violoncello: OK you get a 404, but what IP do you get from nslookup?
#1628 [16:23] <violoncello> Threa- HA! sorry. Totally misread your question.
#1629 [16:23] <violoncello> Threa - 184.73.166.45 and it acks pings.
#1630 [16:24] <Thrae> Yeah that's the correct IP. Hmmm.
#1631 [16:24] <violoncello> And you don't get 404s
#1632 [16:24] <violoncello> ?
#1633 [16:25] <Thrae> Something's happening with your packets and I'm not sure what =/ Do you have a different computer or something like a Linux or Windows dualboot?
#1634 [16:25] * andrewkm [andrewkm@notlogged] has joined #minecrafthelp
#1635 [16:25] <Thrae> violoncello: Nope, I don't get 404 in the browser, and I can login just fine
#1636 [16:27] <violoncello> Threa - two different boxes, same results.
#1637 [16:27] <violoncello> Threa - actually, let me confirm the session.mc.net results on box number 2...
#1638 [16:28] * Lynn [Lynn@notlogged] has joined #minecrafthelp
#1639 [16:30] * Cryp71c [Cryp71c@notlogged] has joined #minecrafthelp
#1640 [16:31] <violoncello> Threa - yup. Same.
#1641 [16:31] <violoncello> Weird. Seems pretty local to … me. My house. hah.
#1642 [16:34] <Thrae> http://isitup.org/session.minecraft.net says 404 too, hmmm....
#1643 [16:34] * Jammy [Jammy@notlogged] has joined #minecrafthelp
#1644 [16:35] <violoncello> Threa - the plot thickens.
#1645 [16:35] * koulchilebaiz [koulchilebaiz@notlogged] has joined #minecrafthelp
#1646 [16:36] <violoncello> Threa - http://www.downforeveryoneorjustme.com/session.minecraft.net concurs.
#1647 [16:39] <violoncello> Threa - maybe you have a cached version? That kinda doesn't make sense…
#1648 [16:39] <Thrae> violoncello: Possible, I use a powerful router.
#1649 [16:42] * The_Prog [The_Prog@notlogged] has joined #minecrafthelp
#1650 [16:42] <The_Prog> Hello?
#1651 [16:42] <Thrae> violoncello: I let other people here know and we'll forward it if need be
#1652 [16:42] <The_Prog> Can me help everybody
#1653 [16:43] <Thrae> The_Prog: Sure, if you know the answer, feel free to help people.
#1654 [16:44] * guest-0-84136 [guest-0-84136@notlogged] has joined #minecrafthelp
#1655 [16:44] <The_Prog> I dont know the answer
#1656 [16:44] <dakinthebox> how do i update my client? i just loaded a 1.9 pre 5 on my dedicated server but when i try to connect it says client outdated
#1657 [16:44] <dakinthebox> i did a force update
#1658 [16:44] <Thrae> The_Prog: Are you saying *you* need help?
#1659 [16:44] <violoncello> Threa - awesome! Thank you so much. (I don't know who "other people" are, but that sounds ominous and effective.) :- )
#1660 [16:44] <dakinthebox> didnt help[
#1661 [16:45] <Thrae> dakinthebox: 1.9 is still in pre-release. It won't auto-update until it's stable.
#1662 [16:45] <Thrae> ?? 1.9
#1663 [16:45] <VoxelHead> 1.9: The 1.9 releases are not supported as they are known to be buggy and unstable. If you want to use them anyhow:
#1664 [16:45] <VoxelHead> 1.9: 1.9 prerelease Minecraft client: http://assets.minecraft.net/1_9-pre5/minecraft.jar -- 1.9 prerelease Minecraft server: http://assets.minecraft.net/1_9-pre5/minecraft_server.jar
#1665 [16:45] <dakinthebox> thank you
#1666 [16:45] <dakinthebox> thank you
#1667 [16:45] * dakinthebox [dakinthebox@notlogged] has left #minecrafthelp
#1668 [16:47] * zkxs [zkxs@notlogged] has joined #minecrafthelp
#1669 [16:49] <The_Prog> can everybody help me please
#1670 [16:49] * bildramer [bildramer@notlogged] has joined #minecrafthelp
#1671 [16:49] <Thrae> The_Prog: We need to know what's wrong first.
#1672 [16:49] <The_Prog> oh ok sorry i dont know what you mean my englisch is not so good
#1673 [16:50] <Thrae> We need a problem to help
#1674 [16:50] <The_Prog> When i start minecraft and login and the progressbar comes then minecraft close and a hs_err_pid comes
#1675 [16:50] <Thrae> The_Prog: Copy what's inside hs_err_pid to www.pastebin.com and give us the URL
#1676 [16:51] <The_Prog> http://pastebin.com/ZgmgDMds
#1677 [16:54] <The_Prog> And?
#1678 [16:54] <Thrae> The_Prog: OK, are you using 32-bit or 64-bit Windows 7?
#1679 [16:54] <The_Prog> 32
#1680 [16:55] <Thrae> The_Prog: Do you know how to update your graphics drivers?
#1681 [16:55] <The_Prog> yes please wait i try it
#1682 [16:58] <The_Prog> my graphic driver is ok
#1683 [16:59] * JohnnyCash [JohnnyCash@notlogged] has joined #minecrafthelp
#1684 [17:00] * mib_v3ckn3 [mib_v3ckn3@notlogged] has joined #minecrafthelp
#1685 [17:00] <Thrae> The_Prog: No, it's not. The error says the graphics driver is NOT ok.
#1686 [17:00] * raisin [raisin@notlogged] has joined #minecrafthelp
#1687 [17:00] <Thrae> ??> The_Prog win/dxdiag
#1688 [17:00] <VoxelHead> The_Prog: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#1689 [17:00] <VoxelHead> The_Prog: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#1690 [17:00] <Thrae> The_Prog: Follow VoxelHead's instructions and I can help you update your graphics driver.
#1691 [17:00] <raisin> Can someone help me?
#1692 [17:00] * JohnnyCash [JohnnyCash@notlogged] has joined #minecrafthelp
#1693 [17:01] <The_Prog> where is voxelhead's
#1694 [17:01] <raisin> my minecraft beta keeps saying fatal error 4 null over and over wont update or load
#1695 [17:01] <raisin> plz help!!
#1696 [17:02] <The_Prog> My DxDiag http://pastebin.com/mmdf93yC
#1697 [17:02] <lemon-rev> raisin unfortunally atm minecraft.net is kinda half down
#1698 [17:02] <lemon-rev> just keep trying please
#1699 [17:02] <raisin> i have tried for 1.5 hours
#1700 [17:02] <rymate1234> lol
#1701 [17:02] <GreyVulpine> raisin -Do you run avira?
#1702 [17:02] <raisin> yes
#1703 [17:02] <GreyVulpine> That would be why
#1704 [17:02] <raisin> i run avira
#1705 [17:02] <raisin> why
#1706 [17:03] <raisin> whats it do
#1707 [17:03] <rymate1234> its bad
#1708 [17:03] <raisin> blocks minecraft?
#1709 [17:03] <GreyVulpine> Yes, avira is blocking minecraft
#1710 [17:03] <raisin> what should i do to make it work
#1711 [17:04] <GreyVulpine> ?? win/avira
#1712 [17:04] <GreyVulpine> bleh
#1713 [17:04] <GreyVulpine> ??< index
#1714 [17:04] <rymate1234> uninstall avira
#1715 [17:04] <rymate1234> install avg free
#1716 [17:04] <raisin> oh ok
#1717 [17:04] <raisin> what about Norton
#1718 [17:04] <rymate1234> lol no
#1719 [17:04] <raisin> ok
#1720 [17:04] <raisin> thanks!
#1721 [17:04] <rymate1234> not norton
#1722 [17:04] <rymate1234> not norton
#1723 [17:04] * raisin [raisin@notlogged] has left #minecrafthelp
#1724 [17:05] * Zennyzen [Zennyzen@notlogged] has joined #minecrafthelp
#1725 [17:05] <Zennyzen> Hallo
#1726 [17:05] <The_Prog> Servus
#1727 [17:05] <rymate1234> lol
#1728 [17:06] * pheleas_frog [pheleas_frog@notlogged] has joined #minecrafthelp
#1729 [17:06] <pheleas_frog> how do i dowloud flatt map grass map
#1730 [17:06] <The_Prog> Thrae and what do you know
#1731 [17:06] <GreyVulpine> pheleas_frog - For classic or beta?
#1732 [17:06] <pheleas_frog> beta
#1733 [17:07] <GreyVulpine> There is no such thing. Once you go to the edge of a beta map, it generates more random terrain
#1734 [17:08] * [1]Jackson413 [[1]Jackson413@notlogged] has joined #minecrafthelp
#1735 [17:09] <The_Prog> Thrae
#1736 [17:09] <pheleas_frog> i am at home bured and want to play online minecraft waht is ip for a good server?
#1737 [17:09] <GreyVulpine> ?? smp/servers
#1738 [17:09] <VoxelHead> smp/servers: There currently is no master list of all SMP servers. Fan-made indexes include http://minestatus.net/ - http://www.mcserverlist.net/ - http://www.reddit.com/r/mcservers - http://minecraftservers.net/ - http://minecraft.dk/mcserverlist/
#1739 [17:09] <VoxelHead> smp/servers: You can also find a list at the MC forums at http://www.minecraftforum.net/viewforum.php?f=1025. Also, try the #smp channel.
#1740 [17:09] <pheleas_frog> my pc is accer
#1741 [17:10] <Thrae> ??> The_Prog win/dxdiag
#1742 [17:10] <VoxelHead> The_Prog: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#1743 [17:10] <VoxelHead> The_Prog: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#1744 [17:10] <Thrae> The_Prog: Follow what VoxelHead is telling you ^^^^^^^^
#1745 [17:11] <GreyVulpine> Thrae - He did
#1746 [17:11] <GreyVulpine> http://pastebin.com/mmdf93yC
#1747 [17:11] <Thrae> Ah sorry, missed it
#1748 [17:11] <GreyVulpine> Looks like these drivers are for you prog.
#1749 [17:11] <GreyVulpine> http://downloadcenter.intel.com/Detail_Desc.aspx?agr=Y&DwnldID=18223&ProdId=2880&lang=eng
#1750 [17:11] <The_Prog> http://pastebin.com/ZqMttqrL
#1751 [17:12] <pheleas_frog> how do i dowloud mod 1.7
#1752 [17:12] <GreyVulpine> pheleas_frog - Mod 1.7?
#1753 [17:12] <Thrae> The_Prog: Follow what GreyVulpine is telling you
#1754 [17:12] <pheleas_frog> soyry 1.4
#1755 [17:12] <GreyVulpine> pheleas_frog - Still have no idea what you're talking about
#1756 [17:12] <pheleas_frog> sory
#1757 [17:14] <pheleas_frog> how do i dowloud a classick mod?
#1758 [17:15] <GreyVulpine> Classic is different from beta. In classic, the maps were of a static size, there was no way for a map to grow bigger. In beta, the map generator is completely redesigned. Once you get to the edge of a beta map, it generates more random terrain
#1759 [17:15] <GreyVulpine> Even if you did a pre-generated flat grass map in beta, once you get to the edge of it, minecraft will generate hills and valleys, and trees.
#1760 [17:25] * gretchen [gretchen@notlogged] has joined #minecrafthelp
#1761 [17:26] <The_Prog> what has grey vulpix to me say? sorry
#1762 [17:26] * Hisui_ [Hisui_@notlogged] has joined #minecrafthelp
#1763 [17:28] <The_Prog> Grey vulpix
#1764 [17:28] <Thrae> The_Prog: Install this graphics driver update -- http://downloadcenter.intel.com/Detail_Desc.aspx?agr=Y&DwnldID=18223&ProdId=2880&lang=eng
#1765 [17:28] * mib_kwx2oz [mib_kwx2oz@notlogged] has joined #minecrafthelp
#1766 [17:28] <The_Prog> THANKS I TRY IT
#1767 [17:29] <The_Prog> wait
#1768 [17:31] * w [w@notlogged] has joined #minecrafthelp
#1769 [17:36] * shay25 [shay25@notlogged] has joined #minecrafthelp
#1770 [17:36] <The_Prog> minercraft is running but a error in minecraft
#1771 [17:36] <The_Prog> http://pastebin.com/mWdFr3hp
#1772 [17:38] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#1773 [17:38] <The_Prog> i try it
#1774 [17:42] <shay25> hey guys anyone here?
#1775 [17:43] <almostroot> shay25: What;s up?
#1776 [17:44] <almostroot> What's*
#1777 [17:45] <violoncello> Threa - looks like it's working again.
#1778 [17:45] <shay25> hey just a question
#1779 [17:45] <shay25> i downloaded Daren's FlatMap Gen
#1780 [17:46] <shay25> and it made me a flat map
#1781 [17:46] <shay25> but how do i use it as a non survival mode.. bascily all i wanted is a flat map i can creat w/e i want on
#1782 [17:46] <violoncello> Threa - not sure if it was due to re-installing the launcher, or if the session.mc.net services came back...
#1783 [17:46] <shay25> like these people building citys and stuff
#1784 [17:48] * Campy [Campy@notlogged] has joined #minecrafthelp
#1785 [17:51] * Tuukan [Tuukan@notlogged] has joined #minecrafthelp
#1786 [17:51] * Tuukan [Tuukan@notlogged] has joined #minecrafthelp
#1787 [17:51] * Tuukan [Tuukan@notlogged] has left #minecrafthelp
#1788 [17:58] * AuBot` [AuBot`@notlogged] has joined #minecrafthelp
#1789 [18:09] * mib_z0t4an [mib_z0t4an@notlogged] has joined #minecrafthelp
#1790 [18:09] <mib_z0t4an> i need help
#1791 [18:10] <mib_z0t4an> my minecraft dont work
#1792 [18:10] <mib_z0t4an> can someone help me
#1793 [18:11] * amphibulus [amphibulus@notlogged] has joined #minecrafthelp
#1794 [18:11] <amphibulus> hi
#1795 [18:12] <amphibulus> plz help
#1796 [18:16] * tyboss18 [tyboss18@notlogged] has joined #minecrafthelp
#1797 [18:16] <tyboss18> can anyone help with my crash problem
#1798 [18:16] <lemon-rev> tyboss18 are you running a mod ?
#1799 [18:16] <tyboss18> nope
#1800 [18:17] <lemon-rev> tyboss18 so whats the game doing ?
#1801 [18:17] <tyboss18> when i run it it takes me back to the desktop and a crash report pops up
#1802 [18:18] <lemon-rev> can you open that crash report up and pastebin.com it please
#1803 [18:18] <tyboss18> yes
#1804 [18:18] * Hawkhead [Hawkhead@notlogged] has joined #minecrafthelp
#1805 [18:19] <tyboss18> # # A fatal error has been detected by the Java Runtime Environment: # # EXCEPTION_ACCESS_VIOLATION (0xc0000005) at pc=0x6906bed5, pid=2528, tid=3416 # # JRE version: 6.0_27-b07 # Java VM: Java HotSpot(TM) Client VM (20.2-b06 mixed mode windows-x86 ) # Problematic frame: # C [atioglxx.dll+0x6bed5] # # If you would like to submit a bug report, please visit:
#1806 [18:19] * JabbuhWocky [JabbuhWocky@notlogged] has joined #minecrafthelp
#1807 [18:19] <JabbuhWocky> Hello
#1808 [18:20] <lemon-rev> hm
#1809 [18:20] <JabbuhWocky> I need help.
#1810 [18:20] <Hawkhead> hello
#1811 [18:20] <lemon-rev> tyboss18 windows / mac ?
#1812 [18:20] <JabbuhWocky> windows.
#1813 [18:20] <lemon-rev> ??> JabbuhWocky ask
#1814 [18:20] <VoxelHead> JabbuhWocky: (ask) Don't ask to ask or just say "I need help" - just ask your question or state what you need help with, and be as specific as possible.
#1815 [18:20] <JabbuhWocky> Ive had MineCraft For a while now,
#1816 [18:20] <VoxelHead> JabbuhWocky: (ask) If you are unsure if the question is appropriate, just ask it and you will be informed if it is not.
#1817 [18:20] <tyboss18> windows xp
#1818 [18:20] <lemon-rev> ok
#1819 [18:20] <JabbuhWocky> Ok
#1820 [18:20] <JabbuhWocky> So ive had mc for a while
#1821 [18:20] <JabbuhWocky> and yes xp
#1822 [18:20] <lemon-rev> tyboss18 can you please follow vox
#1823 [18:20] <JabbuhWocky> however ive been playing browser.
#1824 [18:20] <lemon-rev> ??> tyboss18 win/dxdiag
#1825 [18:20] <VoxelHead> tyboss18: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#1826 [18:20] <VoxelHead> tyboss18: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#1827 [18:21] <JabbuhWocky> My power is in and out and also im leaving on a airplane
#1828 [18:21] <JabbuhWocky> My client just makes a beeping sound and will not Start.
#1829 [18:21] <JabbuhWocky> What Do I Do?
#1830 [18:21] <JabbuhWocky> Ive re-downloaded 3-4 times now.
#1831 [18:21] * guest-0-03872 [guest-0-03872@notlogged] has joined #minecrafthelp
#1832 [18:21] <lemon-rev> JabbuhWocky so the web broswer version works ?
#1833 [18:21] <JabbuhWocky> Yea.
#1834 [18:21] <JabbuhWocky> My brother bought MC for me
#1835 [18:21] <JabbuhWocky> like
#1836 [18:21] <lemon-rev> JabbuhWocky what antivirus program are you running ?
#1837 [18:21] <JabbuhWocky> 8 days ago
#1838 [18:22] <JabbuhWocky> ...
#1839 [18:22] <JabbuhWocky> Avia
#1840 [18:22] <JabbuhWocky> avira
#1841 [18:22] <JabbuhWocky> and zone alarm
#1842 [18:22] <lemon-rev> vox will block you for pressing enter too many times please put 1 line if you can
#1843 [18:22] <JabbuhWocky> um
#1844 [18:22] <JabbuhWocky> ok
#1845 [18:22] <tyboss18> http://mibpaste.com/b7fyxF
#1846 [18:22] <JabbuhWocky> but i allowed it on ALL anti virus softawre i have.
#1847 [18:22] * Steve[mbp] [Steve[mbp]@notlogged] has joined #minecrafthelp
#1848 [18:23] <lemon-rev> avira i belive has a trouble with the files of minecraft and you basicly need to disable it or uninstall it, for minecraft not to be blocked
#1849 [18:23] <JabbuhWocky> Kk lemme try that.
#1850 [18:23] <tyboss18> there u go
#1851 [18:23] <tyboss18> that my dxdiag
#1852 [18:24] <lemon-rev> tyboss18 that is the error report i would like the dxdiag, when you type in dxdiag you should get a big box showing up that saves all your dxdiag and you can save it as a text
#1853 [18:24] <JabbuhWocky> Im just removing using control pannel that should do it no?
#1854 [18:24] <lemon-rev> JabbuhWocky its still being blocked
#1855 [18:24] <lemon-rev> yes
#1856 [18:25] <JabbuhWocky> Uninstalling atm
#1857 [18:25] <tyboss18> oh i forgot how to do the dxdiag :(
#1858 [18:25] <lemon-rev> tyboss18 on xp goto start / run / type in dxdiag
#1859 [18:25] <JabbuhWocky> well
#1860 [18:25] <JabbuhWocky> It didn't work
#1861 [18:25] <JabbuhWocky> And i have no anti-virus D:
#1862 [18:26] <lemon-rev> JabbuhWocky ok does it still do the same thing ?
#1863 [18:26] <JabbuhWocky> yeah
#1864 [18:26] <lemon-rev> JabbuhWocky check yuor firewall
#1865 [18:28] * Karn [Karn@notlogged] has joined #minecrafthelp
#1866 [18:28] * violoncello [violoncello@notlogged] has joined #minecrafthelp
#1867 [18:29] <tyboss18> lemon-rev: it wont let me paste
#1868 [18:29] <tyboss18> lemon-rev: it wont let me paste
#1869 [18:29] * Karn [Karn@notlogged] has left #minecrafthelp
#1870 [18:30] <lemon-rev> tyboss18 are you opeing the dxdiag.txt with notepad and copying that or trying to drag the txt file into the pastebin.com ?
#1871 [18:31] * JabbuhWocky_COmp [JabbuhWocky_COmp@notlogged] has joined #minecrafthelp
#1872 [18:31] <JabbuhWocky_COmp> back
#1873 [18:31] <JabbuhWocky_COmp> my computer Crashed.
#1874 [18:31] * clemdu40 [clemdu40@notlogged] has joined #minecrafthelp
#1875 [18:31] <JabbuhWocky_COmp> ............
#1876 [18:31] <lemon-rev> ...
#1877 [18:31] <tyboss18> i copyed my dxdiag and pasted it to pastbin
#1878 [18:31] <clemdu40> Hello
#1879 [18:31] <clemdu40> I search a teleportation plugin with a dump inventory during the teleportation.
#1880 [18:31] <clemdu40> I am French
#1881 [18:32] <lemon-rev> tyboss18 what happens if you try to sumbit it
#1882 [18:32] <clemdu40> PLEASE HELP-ME
#1883 [18:32] <lemon-rev> ??> clemdu40 mods
#1884 [18:32] <VoxelHead> clemdu40: (mods) This channel is not a venue for mod support, or support for modded servers, as it is impossible for anybody to know every combination of mods out there, this channel does not assist with unofficial third-party modded content.
#1885 [18:32] <VoxelHead> clemdu40: (mods) For single player mods, contact the mod's creator or try http://tiny.cc/modinstall for general installation instructions. For bukkit help, use #bukkit; you can also try using Google to search for a mod's installation instructions.
#1886 [18:32] <clemdu40> Plugi
#1887 [18:32] <JabbuhWocky_COmp> My client won't work.
#1888 [18:32] <clemdu40> n*
#1889 [18:32] <JabbuhWocky_COmp> Makes the beeping sound.
#1890 [18:32] <tyboss18> it says its too big
#1891 [18:32] <lemon-rev> JabbuhWocky ok i asked you to check your firewall can you please try
#1892 [18:33] <JabbuhWocky_COmp> I removed it.
#1893 [18:33] <JabbuhWocky_COmp> The avira?
#1894 [18:33] <JabbuhWocky_COmp> yeah i got rid of the program.
#1895 [18:33] <lemon-rev> tyboss18 ok just copy the first half of it then pleae
#1896 [18:33] <lemon-rev> JabbuhWocky_COmp i ment firewall , i knwo you removed your antivirus
#1897 [18:33] <JabbuhWocky_COmp> well
#1898 [18:33] <JabbuhWocky_COmp> my computer crashed
#1899 [18:34] <lemon-rev> i know
#1900 [18:34] <JabbuhWocky_COmp> so i didn't see.
#1901 [18:34] <JabbuhWocky_COmp> How do i remove my firewall?
#1902 [18:34] <lemon-rev> np
#1903 [18:34] <JabbuhWocky_COmp> or "Checl"
#1904 [18:34] <lemon-rev> no
#1905 [18:34] <JabbuhWocky_COmp> check*
#1906 [18:34] <lemon-rev> JabbuhWocky_COmp use google please
#1907 [18:34] * CrusaderDeleters [CrusaderDeleters@notlogged] has joined #minecrafthelp
#1908 [18:34] <JabbuhWocky_COmp> I cant if i don't exactly know what you want me to do.
#1909 [18:34] <tyboss18> http://mibpaste.com/nb9JME
#1910 [18:34] <tyboss18> there u go
#1911 [18:35] <lemon-rev> JabbuhWocky_COmp its simple ask google 'firewall how to check'
#1912 [18:35] <JabbuhWocky_COmp> it is off.
#1913 [18:36] <lemon-rev> JabbuhWocky_COmp can you also check your username for your computer and does it have a ! in it ?
#1914 [18:36] <clemdu40> I have a lot of teleportation plugins but I want a plugin with a dump inventory during the teleportation
#1915 [18:36] <JabbuhWocky_COmp> no
#1916 [18:36] <clemdu40> Help
#1917 [18:37] <clemdu40> HELP ME THANKS
#1918 [18:37] <lemon-rev> tyboss18 http://support.amd.com/us/gpudownload/windows/Legacy/Pages/radeonaiw_xp.aspx?type=2.4.1&product=2.4.1.3.13&lang=English < can you get the option 1 full suite your drivers are amazingly out of date
#1919 [18:38] <lemon-rev> clemdu40 you want your game to work ' FORCE UPDATE'
#1920 [18:38] <clemdu40> Lemon ?
#1921 [18:38] <lemon-rev> what ?
#1922 [18:38] <JabbuhWocky_COmp> So am I just screwed?
#1923 [18:39] <lemon-rev> hm
#1924 [18:39] <lemon-rev> ill get you to do this for me
#1925 [18:39] <lemon-rev> ??> JabbuhWocky_COmp win/dxdiag
#1926 [18:39] <VoxelHead> JabbuhWocky_COmp: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#1927 [18:39] <VoxelHead> JabbuhWocky_COmp: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#1928 [18:39] <clemdu40> You don't know a plugin ?
#1929 [18:39] <JabbuhWocky_COmp> Whats that
#1930 [18:40] <JabbuhWocky_COmp> I dont understand what a "Win" key is
#1931 [18:40] <lemon-rev> clemdu40 a plugin is a mod to us in here and we dont support it
#1932 [18:40] <lemon-rev> win key is usually found between alt + ctrl keys
#1933 [18:40] <JabbuhWocky_COmp> is it the one with the flag on it?
#1934 [18:40] * yoshi [yoshi@notlogged] has joined #minecrafthelp
#1935 [18:41] <lemon-rev> yes
#1936 [18:41] <JabbuhWocky_COmp> nvm got it
#1937 [18:41] <clemdu40> Is There a Channel to the plugins ?
#1938 [18:41] <lemon-rev> only for bukkit
#1939 [18:41] <clemdu40> Thank
#1940 [18:42] <JabbuhWocky_COmp> pastebin wont let me paste.
#1941 [18:42] <yoshi> when i open minecraft i log in and stuff and i join my world and the screen says saving chunks and then it goes black
#1942 [18:43] <lemon-rev> JabbuhWocky_COmp can you copy half of it for me then please
#1943 [18:43] <lemon-rev> yoshi can you make sure java is uptodate please
#1944 [18:43] <JabbuhWocky_COmp> idk
#1945 [18:43] <JabbuhWocky_COmp> Where do i paste it?
#1946 [18:43] <JabbuhWocky_COmp> Your asking for files arent you?
#1947 [18:43] <yoshi> how do i check that
#1948 [18:43] <yoshi> if java is updated
#1949 [18:44] <lemon-rev> JabbuhWocky_COmp you open the txt file it saves with notepad and you only select half the file copy it, then paste it where i want you to please
#1950 [18:44] <lemon-rev> yoshi java.com < goto download it will tell you
#1951 [18:44] <JabbuhWocky_COmp> k
#1952 [18:45] * HELPME [HELPME@notlogged] has joined #minecrafthelp
#1953 [18:45] <HELPME> HELP
#1954 [18:45] <JabbuhWocky_COmp> kk
#1955 [18:45] <JabbuhWocky_COmp> i pasted ALL into pastebin
#1956 [18:45] <HELPME> I cant play minecraft on my mac its to lagy
#1957 [18:45] <lemon-rev> HELPME do not yell
#1958 [18:46] * Skull_bounche [Skull_bounche@notlogged] has joined #minecrafthelp
#1959 [18:46] <HELPME> and i have 12 g of ram!
#1960 [18:46] <JabbuhWocky_COmp> http://pastebin.com/Dm60Lc9Z
#1961 [18:46] <lemon-rev> HELPME two things you can try make sure your java is fully updated turn the graphics down in game, and try to run in broswer version
#1962 [18:46] <lemon-rev> ty JabbuhWocky_COmp
#1963 [18:46] <Skull_bounche> http://mibpaste.com/0WOspX help me whit this
#1964 [18:47] <yoshi> i chekd to se if java was updated and it was so wat do i do now
#1965 [18:47] <lemon-rev> ok JabbuhWocky_COmp that was good but i need the top half sorry man :)
#1966 [18:47] <HELPME> i have mac 10.4 god damnit
#1967 [18:48] <JabbuhWocky_COmp> k
#1968 [18:48] * Marf [Marf@notlogged] has joined #minecrafthelp
#1969 [18:48] <HELPME> im on a server right now and its so lagy i cant do any thing!
#1970 [18:48] <Marf> Just one question, since Minecraft version 1.8, if it rains outside it rains in my house. and I just a closed roof. I find it quite strange ... or is it a bug?
#1971 [18:48] <JabbuhWocky_COmp> http://pastebin.com/P4VX9XsK
#1972 [18:48] <lemon-rev> helpme thats bandwith not your computer
#1973 [18:48] <lemon-rev> try another server
#1974 [18:48] <HELPME> like it just happened like a day ago
#1975 [18:48] <yoshi> no one is helping me help!!!!!
#1976 [18:48] <HELPME> No
#1977 [18:48] <JabbuhWocky_COmp> HELPME then u downloaded stupid stuff
#1978 [18:49] * koulchilebaiz [koulchilebaiz@notlogged] has joined #minecrafthelp
#1979 [18:49] <JabbuhWocky_COmp> One of the only explanations.
#1980 [18:49] <HELPME> its the comp it does it on single player to
#1981 [18:49] <JabbuhWocky_COmp> or servers based somewhere far far away.
#1982 [18:49] <JabbuhWocky_COmp> ok.
#1983 [18:49] <JabbuhWocky_COmp> Then ur comp is crap
#1984 [18:49] <yoshi> fregggin help me!!
#1985 [18:49] <HELPME> is there a viris scaner for mac?
#1986 [18:49] <JabbuhWocky_COmp> Google is good.
#1987 [18:50] <lemon-rev> JabbuhWocky_COmp can you please try this http://www.nvidia.co.uk/object/winxp-285.58-whql-driver-uk.html
#1988 [18:50] <lemon-rev> everyone i am one person and 1 person only atm, helping out you can leave if you dont like it, just stop being soo bloody impatant
#1989 [18:51] <JabbuhWocky_COmp> what am i looking at
#1990 [18:51] <lemon-rev> yoshi where was i when i was talking to you last
#1991 [18:51] <lemon-rev> JabbuhWocky_COmp video card drivers
#1992 [18:51] <JabbuhWocky_COmp> Ok.
#1993 [18:51] <lemon-rev> download and run
#1994 [18:51] <JabbuhWocky_COmp> i can play runescape fine and graphics are better.
#1995 [18:52] <lemon-rev> bah
#1996 [18:52] <JabbuhWocky_COmp> + its an hour download.
#1997 [18:52] <lemon-rev> ??> JabbuhWocky_COmp requrements
#1998 [18:52] <lemon-rev> ??> JabbuhWocky_COmp requirements
#1999 [18:52] <VoxelHead> JabbuhWocky_COmp: (requirements) Minecraft is a modern game, with modern requirements. It is also still under active development, so the code is by no means optimized (what do you expect? It's in beta!). As such, you will not be able to reasonably expect the game to run on a system with less than 1.5GiB of RAM- the game itself allocates 1GB at startup. You will also need a somewhat modern video card and relatively fast CPU.
#2000 [18:53] <JabbuhWocky_COmp> yeah but my client never even starts.
#2001 [18:53] <lemon-rev> JabbuhWocky_COmp just please bare with me, install the drivers and then we can go from there
#2002 [18:53] <JabbuhWocky_COmp> well that will be 3 hours from now.
#2003 [18:54] <lemon-rev> sorry to hear that
#2004 [18:55] * Marf [Marf@notlogged] has joined #minecrafthelp
#2005 [18:56] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#2006 [18:56] * Banana [Banana@notlogged] has joined #minecrafthelp
#2007 [18:56] * Banana [Banana@notlogged] has joined #minecrafthelp
#2008 [18:58] * Banana [Banana@notlogged] has left #minecrafthelp
#2009 [19:00] * mib_5dtdg4 [mib_5dtdg4@notlogged] has joined #minecrafthelp
#2010 [19:02] * kermie [kermie@notlogged] has joined #minecrafthelp
#2011 [19:02] * mib_4gjldw [mib_4gjldw@notlogged] has joined #minecrafthelp
#2012 [19:03] * Pulec [Pulec@notlogged] has joined #minecrafthelp
#2013 [19:03] * mib_vmbrvl [mib_vmbrvl@notlogged] has joined #minecrafthelp
#2014 [19:04] <mib_4gjldw> .
#2015 [19:04] <mib_vmbrvl> i downloaded the game but when i tried to play it it just goes to a black screen
#2016 [19:05] <mib_4gjldw> damn
#2017 [19:05] <mib_4gjldw> i purchased the game
#2018 [19:05] <lemon-rev> mib_vmbrvl try going to java.com and makeing sure its uptodate
#2019 [19:05] <mib_4gjldw> some months ao
#2020 [19:05] <mib_vmbrvl> it is
#2021 [19:05] * mr_wibble [mr_wibble@notlogged] has joined #minecrafthelp
#2022 [19:05] <lemon-rev> mib_4gjldw so whats the game doing ?
#2023 [19:05] <lemon-rev> mib_vmbrvl exactly what version is that ?
#2024 [19:06] <mib_vmbrvl> 1.81
#2025 [19:06] <mib_4gjldw> someone help me? i got problem i purchased game some months ago and now i cant login it write i dont have premium account
#2026 [19:06] <lemon-rev> no thats minecraft version, im asking about your java version
#2027 [19:06] <mib_vmbrvl> oh
#2028 [19:06] <lemon-rev> mib_4gjldw try going to minecraft.net and login and click in broswer for us
#2029 [19:06] <mib_vmbrvl> 1.4.2
#2030 [19:06] <lemon-rev> mib_vmbrvl needs to be updated
#2031 [19:07] <JabbuhWocky_COmp> 12 minutes/
#2032 [19:07] <lemon-rev> java.com
#2033 [19:07] * bildramer [bildramer@notlogged] has joined #minecrafthelp
#2034 [19:07] <JabbuhWocky_COmp> minutes*
#2035 [19:07] <mib_4gjldw> it wrote i must buy game
#2036 [19:07] <lemon-rev> mib_4gjldw whats your username
#2037 [19:07] <mib_vmbrvl> thnx
#2038 [19:07] <mib_4gjldw> PMkomornik
#2039 [19:07] <mib_vmbrvl> MacDerUntoten
#2040 [19:07] <lemon-rev> !paid PMkomornik
#2041 [19:07] * kendle [kendle@notlogged] has joined #minecrafthelp
#2042 [19:07] <mib_4gjldw> i payd
#2043 [19:08] <mib_4gjldw> 20 zł
#2044 [19:08] <lemon-rev> mib_4gjldw if you have the recipt then go to minecraft.net and login if you can and see if you can get to the help menu on minecraft.net
#2045 [19:08] <mib_4gjldw> ok where
#2046 [19:08] <mib_4gjldw> is help button
#2047 [19:09] <mib_4gjldw> ?
#2048 [19:09] <lemon-rev> ill look
#2049 [19:09] <mib_4gjldw> ok
#2050 [19:10] * Me4502 [Me4502@notlogged] has joined #minecrafthelp
#2051 [19:10] <zkxs> http://www.minecraft.net/support/
#2052 [19:10] * Me4502 [Me4502@notlogged] has joined #minecrafthelp
#2053 [19:11] <mib_4gjldw> thx man
#2054 [19:11] <mib_vmbrvl> im installing java again
#2055 [19:12] <lemon-rev> k
#2056 [19:13] <mib_vmbrvl> i still get a black screen
#2057 [19:14] <lemon-rev> mib_vmbrvl did i get you to update java or video drivers
#2058 [19:15] <mib_vmbrvl> how do u update java
#2059 [19:15] <lemon-rev> java.com < and just hit the big red download button
#2060 [19:15] <mib_vmbrvl> thats wat i did
#2061 [19:15] <lemon-rev> ok
#2062 [19:16] <lemon-rev> mib_vmbrvl did i get you to do a dxdiag yet ?
#2063 [19:16] <lemon-rev> windows / mac ?
#2064 [19:16] <mib_vmbrvl> windows
#2065 [19:16] <lemon-rev> ??> mib_vmbrvl win/dxdiag
#2066 [19:16] <VoxelHead> mib_vmbrvl: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#2067 [19:16] <VoxelHead> mib_vmbrvl: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#2068 [19:19] * calatalee [calatalee@notlogged] has joined #minecrafthelp
#2069 [19:19] <mib_vmbrvl> i did
#2070 [19:20] <lemon-rev> did you paste the link,
#2071 [19:20] <lemon-rev> in here, the http ?
#2072 [19:20] * zippity [zippity@notlogged] has joined #minecrafthelp
#2073 [19:20] <zippity> Is any one out there that can help me?
#2074 [19:20] <mib_vmbrvl> http://pastebin.com/pzsFzC0k
#2075 [19:20] * Jammy [Jammy@notlogged] has joined #minecrafthelp
#2076 [19:21] <lemon-rev> zippity windows / mac ?
#2077 [19:21] <lemon-rev> mib_vmbrvl did i get you to update your video drivers with a link ?
#2078 [19:21] <mib_vmbrvl> no
#2079 [19:21] <lemon-rev> ok give me a min
#2080 [19:22] <zippity> windows I think I pressed something while playing and now icant drag and craft stuff it just goes to the avavile slot in my inventory
#2081 [19:22] * Kyll [Kyll@notlogged] has joined #minecrafthelp
#2082 [19:22] <zippity> Lemon?
#2083 [19:22] <calatalee> would i be able to play the full version if on the classic version demo thing it says lwgjl-_applet.jar.pack unable to get input from stream
#2084 [19:22] <lemon-rev> zippity not sure whats up with that game , you could try doing a reboot sounds like the keyboards gone heywaire
#2085 [19:23] <Thunder7102> What is the link to permissionsex help?
#2086 [19:23] <lemon-rev> mib_vmbrvl http://support.amd.com/us/gpudownload/windows/Legacy/Pages/radeonaiw_xp.aspx?type=2.4.1&product=2.4.1.3.13&lang=English < download and install
#2087 [19:23] <lemon-rev> wtf, i dont know
#2088 [19:24] <lemon-rev> calatalee classic is different from beta
#2089 [19:24] <mib_vmbrvl> im downloading it
#2090 [19:24] <lemon-rev> calatalee just get minecraft demo useing google, and try it
#2091 [19:25] <JabbuhWocky_COmp> 3 minutes
#2092 [19:26] <calatalee> i meant minecraft full version
#2093 [19:26] <Kyll> Hello! I have a question: Where can I report a bug?
#2094 [19:26] <Me4502> #minecraft
#2095 [19:26] <Me4502> zippity: Always happens to me, reopen MINECRAFT, get new LWJGL libraries to fix it permanently so it can never happen again
#2096 [19:26] <Me4502> It's a bug in that version of LWJGL
#2097 [19:26] <Me4502> but reopenign mc works too
#2098 [19:27] <calatalee> but will it work with full version
#2099 [19:27] * tyteen4a03 [tyteen4a03@notlogged] has joined #minecrafthelp
#2100 [19:27] <mib_vmbrvl> i downloaded it
#2101 [19:28] <Boreeas> Kyll: http://getsatisfaction.com/mojang/
#2102 [19:28] * Guest57587 [Guest57587@notlogged] has joined #minecrafthelp
#2103 [19:28] <Kyll> I'll take a look, thanks!
#2104 [19:29] <mib_vmbrvl> my computer says i shouldn't install it
#2105 [19:29] <Kyll> That's it, thank you, have a nice day!
#2106 [19:30] <mib_vmbrvl> hello, lemon-rev
#2107 [19:30] * itsmedamon- [itsmedamon-@notlogged] has joined #minecrafthelp
#2108 [19:31] <lemon-rev> yo ?
#2109 [19:31] <mib_vmbrvl> my computer says i shouldn't install it
#2110 [19:31] <lemon-rev> hm, its just video drivers
#2111 [19:31] <mib_vmbrvl> so i shouln
#2112 [19:31] <lemon-rev> i cant see why not, is it a hp by any chance, or a compac ?
#2113 [19:32] <mib_vmbrvl> idk
#2114 [19:32] <lemon-rev> mib_vmbrvl on the case it self is that a desktop ?
#2115 [19:32] <mib_vmbrvl> wat
#2116 [19:33] <lemon-rev> mib_vmbrvl does it have a box, or is it a small laptop ?
#2117 [19:33] <mib_vmbrvl> a box
#2118 [19:33] <lemon-rev> mib_vmbrvl on the box does it have any logo on it ?
#2119 [19:33] <mib_vmbrvl> IBM
#2120 [19:33] <JabbuhWocky_COmp> drivers are installing
#2121 [19:33] <lemon-rev> ok JabbuhWocky_COmp
#2122 [19:34] <lemon-rev> mib_vmbrvl it should install with np, all they should be is an updated version of drivers yea
#2123 [19:35] <mib_vmbrvl> its still saying the same thing
#2124 [19:35] <JabbuhWocky_COmp> restarting comp.
#2125 [19:35] <calatalee> would i be able to play the full version if on the classic version demo thing it says lwgjl-_applet.jar.pack unable to get input from stream
#2126 [19:35] <lemon-rev> mib_vmbrvl whats it doing ?
#2127 [19:36] <calatalee> minecraft says unable to connect with leg pack thing
#2128 [19:36] <lemon-rev> calatalee google minecraft demo < not minecraft classic
#2129 [19:36] <calatalee> i ment lwg
#2130 [19:36] <lemon-rev> calatalee update java
#2131 [19:36] <mib_vmbrvl> it says it has not passed windows logo testing to verify its compatibility with windows xp
#2132 [19:36] <calatalee> it doesnt work the google demo
#2133 [19:37] <calatalee> and java doesnt update
#2134 [19:37] <lemon-rev> mib_vmbrvl it maybe doesnt need to but its a verrified site from ati, catalyst drivers
#2135 [19:37] <lemon-rev> calatalee what version is it at ?
#2136 [19:37] * mib_z14k1p [mib_z14k1p@notlogged] has joined #minecrafthelp
#2137 [19:37] <mib_vmbrvl> so should i try to install it again?
#2138 [19:38] <lemon-rev> mib_vmbrvl it should install if you just allow it to do so
#2139 [19:38] <calatalee> i dont know what version it is
#2140 [19:38] <calatalee> when i try it sais failed connection
#2141 [19:38] <lemon-rev> calatalee goto java.com and click on the button and tell me what it says on the home page
#2142 [19:39] <lemon-rev> calatalee what says failed connection ?
#2143 [19:39] * curmet [curmet@notlogged] has joined #minecrafthelp
#2144 [19:39] * WouldBeSaint [WouldBeSaint@notlogged] has joined #minecrafthelp
#2145 [19:40] * mermi [mermi@notlogged] has joined #minecrafthelp
#2146 [19:40] * vodkamartini [vodkamartini@notlogged] has joined #minecrafthelp
#2147 [19:41] <WouldBeSaint> Hey guys im having an issue... I just bought minecraft, and tried to run the executable, and it locks my computer up and doesn't execute properly. When I right click it to "Run as administrator I get the minecraft launcher to come up, but it just displays black. I found online it could be a JAVA issue, so I uninstalled and reinstalled java to no result
#2148 [19:41] * DarkSkyes [DarkSkyes@notlogged] has joined #minecrafthelp
#2149 [19:42] <lemon-rev> WouldBeSaint try java.com and makeing sure its uptodate
#2150 [19:42] <WouldBeSaint> my specs are: Windows 7, 64- bit - 8gb ram, 6-core AMD athlon Black Edition
#2151 [19:42] <WouldBeSaint> its completely up to date
#2152 [19:42] <mib_vmbrvl> it says i hav to restart my computer
#2153 [19:42] <lemon-rev> then do so please
#2154 [19:42] <mib_vmbrvl> k
#2155 [19:42] * guest-0-19881 [guest-0-19881@notlogged] has joined #minecrafthelp
#2156 [19:43] <WouldBeSaint> @lemon-rev it is completely up to date
#2157 [19:44] <lemon-rev> ??> WouldBeSaint win/dxdiag
#2158 [19:44] <VoxelHead> WouldBeSaint: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#2159 [19:44] <VoxelHead> WouldBeSaint: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#2160 [19:46] <WouldBeSaint> http://pastebin.com/abGHUXbJ
#2161 [19:47] * cubis47 [cubis47@notlogged] has joined #minecrafthelp
#2162 [19:47] <lemon-rev> WouldBeSaint i dont see why its not working can you goto minecraft.net login and click in broswer
#2163 [19:47] <cubis47> hi!
#2164 [19:47] * Sun7zu [Sun7zu@notlogged] has joined #minecrafthelp
#2165 [19:48] <cubis47> hello
#2166 [19:49] <WouldBeSaint> ANy ideas?
#2167 [19:49] <lemon-rev> WouldBeSaint i dont see why its not working can you goto minecraft.net login and click in broswer
#2168 [19:50] <cubis47> why i cant wrote on #minecraft?
#2169 [19:50] <lemon-rev> i dont know
#2170 [19:50] <cubis47> cannot send to channel
#2171 [19:51] <WouldBeSaint> in browser just show a blank page after I click it...
#2172 [19:51] <lemon-rev> WouldBeSaint can you confirm what version of java your running ?
#2173 [19:51] <cubis47> where i can speak with notch?
#2174 [19:51] <lemon-rev> lol hes bog
#2175 [19:51] <lemon-rev> blog
#2176 [19:51] * cubis47 [cubis47@notlogged] has joined #minecrafthelp
#2177 [19:52] <cubis47> hey
#2178 [19:52] <cubis47> i go to bed by by
#2179 [19:53] * Coll [Coll@notlogged] has joined #minecrafthelp
#2180 [19:53] <WouldBeSaint> 6.0.290.11
#2181 [19:54] <lemon-rev> WouldBeSaint do you have a ! in your computers username ?
#2182 [19:54] <WouldBeSaint> no
#2183 [19:54] <lemon-rev> WouldBeSaint then i am out of idears please wait for someone else
#2184 [19:54] <WouldBeSaint> Awesome... Thanks for your help
#2185 [19:59] * violoncello [violoncello@notlogged] has joined #minecrafthelp
#2186 [20:01] * tmarble [tmarble@notlogged] has joined #minecrafthelp
#2187 [20:05] * guest-684861-60464 [guest-684861-60464@notlogged] has joined #minecrafthelp
#2188 [20:06] <guest-684861-60464> wow everytime i join both wug and grey are still here
#2189 [20:06] <Ninja> there we go
#2190 [20:06] <GreyVulpine> Many of us leave our computers connected pretty much 24/7, even if we're not here
#2191 [20:07] <Ninja> alright well i have yet another question for you guys
#2192 [20:07] <GreyVulpine> We have many answers.
#2193 [20:07] * Me4502 [Me4502@notlogged] has joined #minecrafthelp
#2194 [20:07] <Ninja> haha very true
#2195 [20:07] <Ninja> well remember that server?
#2196 [20:07] <GreyVulpine> "that server"?
#2197 [20:07] <Ninja> it was on 1.9.5
#2198 [20:08] <Wug> Ninja: like I said, I only leave if I'm restarting my server
#2199 [20:08] * s2dve [s2dve@notlogged] has joined #minecrafthelp
#2200 [20:08] <Ninja> the one i made, and wug i remember that
#2201 [20:08] <GreyVulpine> You'll have to be more specific. There's thousands of MC servers, and probably dozens of 1.9_05
#2202 [20:08] <Ninja> true
#2203 [20:08] <Ninja> but i made one yesterday
#2204 [20:08] <GreyVulpine> Okay?
#2205 [20:09] <Ninja> and sadly i was on 1.9 when i did it
#2206 [20:09] <Ninja> so when i switch back i will most likely have to delete it
#2207 [20:09] <Ninja> correct?
#2208 [20:10] <GreyVulpine> I'm sorry, you'll have to elaborate further.
#2209 [20:10] <WouldBeSaint> Maybe some of you guys can help me with my problem...
#2210 [20:10] <WouldBeSaint> I just bought minecraft, and tried to run the executable, and it locks my computer up and doesn't execute properly. When I right click it to "Run as administrator I get the minecraft launcher to come up, but it just displays black. I found online it could be a JAVA issue, so I uninstalled and reinstalled java to no result
#2211 [20:10] <WouldBeSaint> http://pastebin.com/abGHUXbJ
#2212 [20:11] <WouldBeSaint> Java Version: 6.0.290.11
#2213 [20:11] <Ninja> hey i made a new test world so i could try out 1.9, when i go back to 1.8.1, will i have to delete the world?
#2214 [20:11] <GreyVulpine> Ninja - That's a good question. It would be a good idea to, but I'm not sure if you have to
#2215 [20:12] <Ninja> will it mess the world up?
#2216 [20:12] <GreyVulpine> If there's any new features in the 1.9 release that aren't implemented in 1.8, the minecraft server would likely crash and burn..
#2217 [20:12] <Ninja> i ment in single player
#2218 [20:12] * tmarble [tmarble@notlogged] has joined #minecrafthelp
#2219 [20:12] <GreyVulpine> Since I haven't tested out 1.9 at all, I can't really give you an answer..
#2220 [20:13] <GreyVulpine> Either way, server or SP, if there's stuff in 1.9 that aren't in 1.8, MC would crash
#2221 [20:13] <Ninja> good point
#2222 [20:13] <Ninja> so im most likely just going to have to delete the server and the SP world?
#2223 [20:13] * weirdo [weirdo@notlogged] has joined #minecrafthelp
#2224 [20:13] <GreyVulpine> To be safe, that's what I would do
#2225 [20:14] <clarjon1> or back it up
#2226 [20:14] <clarjon1> just don't use the SP world until 1.9 comes out
#2227 [20:14] <clarjon1> or unless you switch back to 1.9 for testing
#2228 [20:14] <Ninja> yea
#2229 [20:15] <GreyVulpine> WouldBeSaint - Do you get any error reports? Does minecraft crash or just give you a black screen? Have you looked into video drivers?
#2230 [20:15] <Ninja> another thing, since i bought MC for the beta phase, will i have to re-buy the game when it fully comes out?
#2231 [20:15] <GreyVulpine> WouldBeSaint - What operating system are you running? Has minecraft worked before?
#2232 [20:15] <WouldBeSaint> The launcher doesnt even load...
#2233 [20:15] <GreyVulpine> Ninja - Nope
#2234 [20:15] <Ninja> alright
#2235 [20:15] <GreyVulpine> ??> Ninja premium
#2236 [20:15] <VoxelHead> Ninja: (premium) Both Alpha and Beta premium users will get bug fixes, updates, patches, and the final release of the game for free. This has not changed. The only difference between the two is the potential aspect of future expansions beyond final release. Alpha users were promised these future expansions for free, while people that bought it during Beta were not.
#2237 [20:16] <clarjon1> hehe
#2238 [20:16] <clarjon1> i'm an Alpha user :D
#2239 [20:16] * Nam-Ereh-Won [Nam-Ereh-Won@notlogged] has joined #minecrafthelp
#2240 [20:16] <Ninja> oh cool
#2241 [20:16] <WouldBeSaint> here is my specs http://pastebin.com/abGHUXbJ
#2242 [20:16] <clarjon1> GreyVulpine: I love this bot :)
#2243 [20:16] <GreyVulpine> Moment WouldBeSaint...
#2244 [20:16] <GreyVulpine> clarjon1 - Indeed. Without Vox, I wouldn't still be here.
#2245 [20:17] <Wug> lol
#2246 [20:17] <GreyVulpine> WouldBeSaint - That system looks to be more than sufficient for minecraft. Hmm.
#2247 [20:17] <Ninja> so do you all have jobs too?
#2248 [20:17] * GreyVulpine is unemployed and currently looking for work.
#2248 [20:17] <Wug> WouldBeSaint: I think I know what it is
#2249 [20:18] <WouldBeSaint> Wug do tell
#2250 [20:18] <GreyVulpine> If nothing else, it would be a good idea for WouldBeSaint to launch minecraft using a batch file, see what the command line says
#2251 [20:18] <GreyVulpine> Betting it's java
#2252 [20:19] <Wug> WouldBeSaint: go to the control panel
#2253 [20:19] <WouldBeSaint> ok
#2254 [20:19] <WouldBeSaint> Wug... Done
#2255 [20:20] <Wug> in the search bar
#2256 [20:20] <Wug> search for "cleartype"
#2257 [20:20] * itsmedamon- [itsmedamon-@notlogged] has joined #minecrafthelp
#2258 [20:20] <Wug> soz was distracted
#2259 [20:20] <WouldBeSaint> ok done
#2260 [20:20] <Wug> there should be an option for the cleartype tuner or something, click that
#2261 [20:20] <WouldBeSaint> ok done
#2262 [20:21] <Wug> configure it
#2263 [20:21] <WouldBeSaint> All i have is the ability to turn it on or off
#2264 [20:21] <Wug> turn it off then
#2265 [20:21] <Wug> then try again
#2266 [20:23] <Wug> WouldBeSaint: is minecraft working?
#2267 [20:24] <WouldBeSaint> Yeah.... no
#2268 [20:24] <Wug> :tv > WouldBeSaint
#2269 [20:24] <WugBot> WouldBeSaint: (tv) Teamviewer is remote access software, which enables other people to, with your permission, access your computer remotely and attempt to perform troubleshooting and diagnostics. Download and run teamviewer from here: http://www.teamviewer.com/en/index.aspx
#2270 [20:24] <WugBot> WouldBeSaint: (tv) Once teamviewer has been downloaded, run it (you do not have to install it) and PM the person who asked you to get it your teamviewer ID and password, shown in the teamviewer window. Send the private message with /msg user ID: xxx yyy zzz pass: wwww
#2271 [20:24] <WouldBeSaint> Why would cleartype have anything to do with the game not launching?
#2272 [20:24] <Wug> because java is stupid
#2273 [20:25] <Wug> and doesnt properly protect against uninitialized cleartype settings, and blows up when it finds them
#2274 [20:25] <WouldBeSaint> Good to know...
#2275 [20:25] <Wug> just download teamviewer and I'll sort it out
#2276 [20:27] <Wug> DopeGhoti: can you append to a voxelhead factoid
#2277 [20:27] <Wug> without resetting it, I mean
#2278 [20:32] * Coll [Coll@notlogged] has joined #minecrafthelp
#2279 [20:36] * Timmooo [Timmooo@notlogged] has joined #minecrafthelp
#2280 [20:37] * itsmedamon- [itsmedamon-@notlogged] has joined #minecrafthelp
#2281 [20:38] <GreyVulpine> DG can edit the file directly, if you tell him what factoid it is, and what to fix
#2282 [20:41] <Ninja> did i miss something?
#2283 [20:42] * GreyVulpine shakes
#2283 [20:42] <Ninja> is that a no?
#2284 [20:42] * GreyVulpine shakes head, "No>"
#2284 [20:42] <Ninja> oh ok
#2285 [20:42] <Ninja> wait because i dont remember a DG
#2286 [20:42] <Ninja> i mean i see the name
#2287 [20:42] <GreyVulpine> DG - Dopeghoti
#2288 [20:43] <Ninja> but i didnt see him post anything
#2289 [20:43] <GreyVulpine> Nah.
#2290 [20:43] <GreyVulpine> For many clients, if you include the name of the person, it'll notice the person with whatever was said, mentioning you
#2291 [20:44] <GreyVulpine> If I'm not here, and you said something with "greyvulpine", my client would record that line, and pass it along to me when I got back.
#2292 [20:44] <Ninja> ah makes sence
#2293 [20:45] <Wug> ;host WouldBeSaint
#2294 [20:45] <WugBot> Hostname of WouldBeSaint is: c-66-177-101-144.hsd1.fl.comcast.net
#2295 [20:46] <Ninja> grey
#2296 [20:47] <GreyVulpine> That doesn't highlight me.
#2297 [20:47] <Ninja> did you program your bot also?
#2298 [20:47] <GreyVulpine> Yes.
#2299 [20:47] <Wug> all the bots
#2300 [20:47] <GreyVulpine> Including Wug
#2301 [20:47] * itsmedamon- [itsmedamon-@notlogged] has joined #minecrafthelp
#2302 [20:47] <Wug> (except voxelhead) are programmed by the people who use them
#2303 [20:48] <Ninja> oh cool
#2304 [20:48] <TheNoodle> lol
#2305 [20:48] <Ninja> how long did it take you guys to program them?
#2306 [20:48] <TheNoodle> 2 bajillion microseconds.
#2307 [20:48] <Ninja> lol
#2308 [20:48] <Wug> I'm still working on mine, its been maybe 4 months since first connect
#2309 [20:48] <GreyVulpine> For many, bots never are totally finished. They evolve to suit the needs of their creator.
#2310 [20:49] <Ninja> true
#2311 [20:49] * PcJamesy [PcJamesy@notlogged] has joined #minecrafthelp
#2312 [20:49] <Ninja> but like how long has it been since you guys first started programming them?
#2313 [20:49] <Wug> ~4 months
#2314 [20:49] * GreyVulpine shrugs
#2314 [20:49] <Ninja> lol cool
#2315 [20:50] <GreyVulpine> a few months to a year before I was satisfied with what I needed for Greybot to do
#2316 [20:50] <Ninja> and that is?
#2317 [20:50] <TheNoodle> Everything ;)
#2318 [20:50] <GreyVulpine> Primitive Channel management and entertainment
#2319 [20:50] <Ninja> amazing
#2320 [20:50] <Ninja> DOES IT MAKE SANDWITCHES?!
#2321 [20:51] <GreyVulpine> Pfft. No, but it can tell you the weather
#2322 [20:51] <Ninja> how?
#2323 [20:52] <Ninja> i want to know the f-ing weather outside
#2324 [20:52] <GreyVulpine> !weather baltimore
#2325 [20:52] <GreyBot> GreyVulpine: Please narrow your search or search by INTL station ID
#2326 [20:52] <Ninja> "it is cold and if you go outside nude, you wont have any testicles for very long"
#2327 [20:52] <GreyVulpine> !weather baltimore airport
#2328 [20:52] <GreyBot> GreyVulpine: Please narrow your search or search by INTL station ID
#2329 [20:52] <GreyVulpine> Bah
#2330 [20:52] <GreyVulpine> !weather hell
#2331 [20:52] <GreyBot> GreyVulpine: From Cobblestone Creek, Pinckney, Michigan (8:50p Nov 05 11) temp(41.7 F / 5.4 C, feels like 42 F / 5 C) cond(Clear) wind(North at 0.0 mph / 0.0 km/h) hu(70%) dewpnt(33 F / 0 C) bp(30.26 in / 1024.6 hPa (Falling)) clouds(Clear (CLR)) vis(10.0 miles / 16.1 kilometers) uv(0 out of 16)
#2332 [20:52] <GreyBot> Tonight: Mostly clear. Lows 33 to 37. Southeast winds 10 to 15 mph...turning to south.
#2333 [20:53] <Ninja> holy shit
#2334 [20:54] <lemon-rev> lol getting cold are we ?
#2335 [20:54] <GreyVulpine> Yeah, that's michigan for you
#2336 [20:54] <lemon-rev> !weather canberra
#2337 [20:54] <GreyBot> lemon-rev: From Canberra, Capital Territory (11:30a Nov 06 11) temp(82 F / 28 C) cond(Clear) wind(WNW at 12 mph / 18 km/h) hu(37%) dewpnt(54 F / 12 C) bp(29.92 in / 1013 hPa (Falling)) uv(N/A)
#2338 [20:54] <GreyBot> Saturday: Clear. High: 82 F.
#2339 [20:54] <Ninja> im in baltimore (hanover really) and its cold as idk what
#2340 [20:54] <lemon-rev> just a tad difference
#2341 [20:54] <GreyVulpine> I hate you....
#2342 [20:55] <Ninja> why?
#2343 [20:55] <GreyVulpine> Not you, lemon.
#2344 [20:55] <GreyVulpine> Not looking forward to Winter here..
#2345 [20:55] <lemon-rev> yea climate is different from yours its more backwards though
#2346 [20:55] <lemon-rev> GreyVulpine i can understand
#2347 [20:56] <Ninja> grey where are you?
#2348 [20:56] <GreyVulpine> Michigan
#2349 [20:57] <Ninja> oh that makes sence
#2350 [20:57] <Ninja> lemon you?
#2351 [20:57] <Ninja> canberra nvm
#2352 [20:57] <lemon-rev> lol
#2353 [20:57] <lemon-rev> australia
#2354 [20:58] <Ninja> you should have added "mate"
#2355 [20:58] <lemon-rev> lol
#2356 [20:58] <lemon-rev> only do that in speeking terms and i dont really use it, on irc
#2357 [21:01] <Wug> ;search archive
#2358 [21:01] <WugBot> Matches for "archive": No results
#2359 [21:01] <Wug> ;search java
#2360 [21:01] <WugBot> Matches for "java": check/java java java/version/cmd
#2361 [21:01] <GreyVulpine> ;search avira
#2362 [21:01] <WugBot> Matches for "avira": No results
#2363 [21:02] <GreyVulpine> Bah, I know there was an entry for avira, can't remember which bot had it
#2364 [21:02] <Wug> ;+ java/archive You can download old versions of java from here: http://www.oracle.com/technetwork/java/archive-139210.html
#2365 [21:02] <WugBot> Done.
#2366 [21:02] * mib_ms3tgw [mib_ms3tgw@notlogged] has joined #minecrafthelp
#2367 [21:02] <mib_ms3tgw> hello
#2368 [21:03] <Ninja> why hello there ;)
#2369 [21:03] <Ninja> hahaha im just playin wassu[
#2370 [21:03] <mib_ms3tgw> how do i get the pre realease of mincraft 1.9
#2371 [21:03] <Ninja> *wassup
#2372 [21:03] <Ninja> read the top
#2373 [21:04] <TheNoodle> ??< 1.9
#2374 [21:04] <TheNoodle> ??> mib_ms3tgw 1.9
#2375 [21:04] <VoxelHead> mib_ms3tgw: (1.9) The 1.9 releases are not supported as they are known to be buggy and unstable. If you want to use them anyhow:
#2376 [21:04] <VoxelHead> mib_ms3tgw: (1.9) 1.9 prerelease Minecraft client: http://assets.minecraft.net/1_9-pre5/minecraft.jar -- 1.9 prerelease Minecraft server: http://assets.minecraft.net/1_9-pre5/minecraft_server.jar
#2377 [21:04] <Ninja> voxel is a bot?
#2378 [21:05] <mib_ms3tgw> what this file do?
#2379 [21:05] <GreyVulpine> VoxelHead is a bot
#2380 [21:05] <VoxelHead> Lies!
#2381 [21:06] <GreyVulpine> That's what you need to replace your minecraft.jar with to get 1.9 pre
#2382 [21:06] <mib_ms3tgw> shut up bot
#2383 [21:06] <Ninja> hahahaha
#2384 [21:06] <Ninja> voxel are you?
#2385 [21:06] <VoxelHead> No, you!
#2386 [21:06] <mib_ms3tgw> not yet
#2387 [21:06] <Ninja> hahaha
#2388 [21:06] <mib_ms3tgw> i like talking
#2389 [21:07] <Ninja> so do i
#2390 [21:07] <VoxelHead> You talk too much.
#2391 [21:07] <Ninja> VOXEL
#2392 [21:07] <Ninja> answer the question
#2393 [21:07] <VoxelHead> What question?
#2394 [21:07] <mib_ms3tgw> and i am proud of it
#2395 [21:08] <Thunder7102> Hey guys, do you guys know why a bukkit server randomly rejects people? It allows some and gets javaerrors on others.
#2396 [21:08] <GreyVulpine> That's a question for #bukkit
#2397 [21:08] <Ninja> that you are a bot
#2398 [21:08] <VoxelHead> I am a bot.
#2399 [21:09] <Ninja> thats what i thought
#2400 [21:09] <Ninja> wait who made you voxel? or is that classified :P
#2401 [21:10] <VoxelHead> That is classified
#2402 [21:10] * noob101 [noob101@notlogged] has joined #minecrafthelp
#2403 [21:10] <Thunder7102> everyone knows noone ever speaks in bukkit. e.e
#2404 [21:10] <noob101> im back
#2405 [21:10] <GreyVulpine> Well, not many here use bukkit, and even less are willing to help with it
#2406 [21:11] <noob101> i need help with getting 1.9 pre realese to work
#2407 [21:12] * GreyVulpine points to topic
#2407 [21:12] <noob101> you bot
#2408 [21:12] <noob101> HELLO
#2409 [21:13] <TheNoodle> .9) The 1.9 releases are not supported asthey are known to be buggy and unstable.
#2410 [21:13] <TheNoodle> You were told this when you were given the links.
#2411 [21:13] <Ninja> blown
#2412 [21:13] <noob101> k
#2413 [21:13] <noob101> what is so bad about it
#2414 [21:13] <Ninja> now if you continue asking about how to get 1.9 to work, i will introduce you to the hammer
#2415 [21:13] <noob101> what it do
#2416 [21:14] <Ninja> what does the hammer do?
#2417 [21:14] <noob101> no
#2418 [21:14] <noob101> the pre realese
#2419 [21:14] <Ninja> nothing
#2420 [21:15] <Ninja> wait till minecon and the full game comes out
#2421 [21:15] <TheNoodle> noob101, we do not support the pre release because it is just that, a pre release, it's for finding bugs in the game.
#2422 [21:15] <noob101> i have for a long time and even tried modding but that failed
#2423 [21:16] <noob101> i dont type fast
#2424 [21:16] <Ninja> just wait for a few more days
#2425 [21:16] <noob101> weeks
#2426 [21:16] <Ninja> trust me
#2427 [21:16] <Ninja> its worth the wait
#2428 [21:16] <noob101> it is the fith
#2429 [21:16] <Ninja> 18-19
#2430 [21:17] <noob101> so on the 18th it should
#2431 [21:17] <noob101> STILL WEEKS
#2432 [21:17] <Ninja> somewhere on those two day
#2433 [21:17] * Coll_ [Coll_@notlogged] has joined #minecrafthelp
#2434 [21:18] <Ninja> calm down you impatient fool
#2435 [21:18] <noob101> i got the mod for NPC to work but stopped
#2436 [21:18] <Ninja> calm
#2437 [21:18] <Ninja> yourself
#2438 [21:18] <TheNoodle> noob101, we do not support the prerelease, nor do we support mods.
#2439 [21:18] <noob101> i am more calm than YOU
#2440 [21:18] * Guest52495 [Guest52495@notlogged] has joined #minecrafthelp
#2441 [21:18] <noob101> i am not asking about mods
#2442 [21:18] <Ninja> -_- imma ignore that
#2443 [21:19] <TheNoodle> noob101, do you need help getting minecraft to work, and not the prerelease?
#2444 [21:19] <Ninja> noob101
#2445 [21:19] <Ninja> here is what i do
#2446 [21:19] <Ninja> i have learned NOT to use mods nor a texture pack
#2447 [21:19] <noob101> is there another place i can visi for support
#2448 [21:20] <noob101> visit*
#2449 [21:20] <Ninja> i have switched to the 1.9 prerelease just to test it out
#2450 [21:20] <noob101> ok
#2451 [21:20] <TheNoodle> noob101, afaik the only other place would be the minecraft forums.
#2452 [21:20] <Ninja> but it isnt that cool
#2453 [21:21] <noob101> dam
#2454 [21:21] <Ninja> im actually just going to switch back soon to 1.8 so i can play multiplayer
#2455 [21:21] <noob101> i know it is npc
#2456 [21:22] <noob101> :(
#2457 [21:22] <Ninja> because my friends server is on 1.8 and is not buggy
#2458 [21:22] <noob101> BOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO
#2459 [21:22] * RecQuery [RecQuery@notlogged] has joined #minecrafthelp
#2460 [21:22] <TheNoodle> !kick noob101 Come back when you're a bit calmer
#2461 [21:22] * Xais23 [Xais23@notlogged] has joined #minecrafthelp
#2462 [21:22] <TheNoodle> wat.
#2463 [21:23] <TheNoodle> Kealper, why is aubot not opped :O
#2464 [21:23] <noob101> MY MINECRAFT KEEPS glithcing on multiplay
#2465 [21:23] <GreyVulpine> !k noob101
#2466 [21:23] * GreyBot kicked noob101 from #minecrafthelp (Reason: oob101 :<Kicks:845>)
#2467 [21:23] <Xais23> Hey, Minecraft is running rather slow and choppy on my comp but idk why, it's a fairly decent laptop.
#2468 [21:23] <Kealper> uhh....it's nick, one sec
#2469 [21:23] <Ninja> yeah buddy
#2470 [21:24] <Ninja> xais what is wrong with it exactly?
#2471 [21:24] * s2dve [s2dve@notlogged] has joined #minecrafthelp
#2472 [21:24] <Ninja> wug you there?
#2473 [21:24] <Ninja> or grey either way
#2474 [21:24] <Xais23> well, it barely moves when all the video settings are on the default ones. When i kick it down to ditance: short and all that jazz, it's...alright but still choppy and annoying mostly.
#2475 [21:25] <s2dve> I'm looking a bit of help with minecraft.
#2476 [21:25] <Ninja> hmmm
#2477 [21:25] <Kealper> ugh....
#2478 [21:25] <Kealper> aubot is being all kinds of derp right now
#2479 [21:26] <Xais23> Is there anything I can do to clean up my laptop maybe? or anything? I mean it's a simple game, thought almost any decent cpu would run it well.
#2480 [21:26] <Ninja> GreyVulpine Xais23 needs your expertise
#2481 [21:27] <zkxs> Xais23: minecraft likes to use a lot of ram. what do you mean by 'fairly decent'?
#2482 [21:27] <Xais23> How would I check how much ram I have?
#2483 [21:27] <GreyVulpine> Xais23 - What operating system are you on?
#2484 [21:27] <Xais23> windows 7
#2485 [21:27] <Ninja> control panel then system settings
#2486 [21:27] <GreyVulpine> Xais23 - Press ctrl+shift+esc to bring up the task manager.
#2487 [21:27] <Xais23> got cha, 1 sec
#2488 [21:27] * ferdinand [ferdinand@notlogged] has joined #minecrafthelp
#2489 [21:27] <GreyVulpine> Go to the performance tab, what is listed next to physical memory
#2490 [21:27] * Keltinray [Keltinray@notlogged] has joined #minecrafthelp
#2491 [21:29] <Ninja> Grey are you using your own irc client?
#2492 [21:29] <GreyVulpine> "My own irc client"?
#2493 [21:29] <Ninja> like im using the browser for mine
#2494 [21:29] <Xais23> can't find system settings...
#2495 [21:29] <GreyVulpine> I'm using an dedicated IRC client, yes.
#2496 [21:29] <GreyVulpine> Xais23 - Press ctrl+shift+esc to bring up the task manager.
#2497 [21:30] <GreyVulpine> Go to the performance tab, what is listed next to physical memory (total)?
#2498 [21:30] <TheNoodle> Grey is using mIRC 7.17
#2499 [21:30] <Xais23> I ahve one gig
#2500 [21:30] <GreyVulpine> You have one gig of RAM?
#2501 [21:30] <Xais23> yes
#2502 [21:30] * s2dve [s2dve@notlogged] has joined #minecrafthelp
#2503 [21:30] <GreyVulpine> That would be why then.
#2504 [21:30] <Xais23> damn...
#2505 [21:31] * Mega_Murder [Mega_Murder@notlogged] has joined #minecrafthelp
#2506 [21:31] <Ninja> well damn
#2507 [21:31] <Xais23> Alright, well at least I know why now & can tackle it. Thanks guys! Hopefully talk to you some other time about some more mincraft things.
#2508 [21:31] <Ninja> i have 2gigs of ram at the moment
#2509 [21:31] <GreyVulpine> We'll be here
#2510 [21:31] <Xais23> Oh hey yeah, what would be the min for running it?
#2511 [21:31] <Xais23> 2gigs?
#2512 [21:32] <Ninja> what is ctcp version?
#2513 [21:32] <s2dve> Hi. Could someone give me a little help with trying to redownload Minecraft
#2514 [21:32] <Mega_Murder> anyone here have the TOOMANYITEMS mod?
#2515 [21:32] <zkxs> lol, you saw that?
#2516 [21:32] <GreyVulpine> Xais23 - You having 1 gig of RAM is part of the problem. Minecraft itself likes to reserve a gig of RAM for itself. You'll need at least 1.5 to 2 gigs of RAM.
#2517 [21:32] <GreyVulpine> Xais23 - Computers that have 1 gig of RAM, are likely to be old as well. Do you know what video card you have?
#2518 [21:32] <Xais23> what would be a ideal amount to have?
#2519 [21:32] <Ninja> idk it showed up yea
#2520 [21:33] <Ninja> idek what it is xD
#2521 [21:33] <clarjon1> Xais23: He just said
#2522 [21:33] <GreyVulpine> Xais23 - Nowadays? minimum of two, more if you plan on having more than just a few programs open
#2523 [21:33] <clarjon1> Xais23: At least 1.5 - 2 gigs
#2524 [21:33] <zkxs> do it to me: /version zkxs
#2525 [21:33] <clarjon1> zkxs: /version me :D
#2526 [21:33] <Xais23> my video card is...idk lol
#2527 [21:34] <Wug> hey grey, what do you make of this:
#2528 [21:34] <Ninja> zkxs what is it?
#2529 [21:34] <GreyVulpine> Xais23 - Could you give us a dxdiag? Will give us more information about your system
#2530 [21:34] <GreyVulpine> ??> Xais23 win/dxdiag
#2531 [21:34] <VoxelHead> Xais23: (win/dxdiag) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#2532 [21:34] <Wug> http://pastebin.com/5PcRYCjb
#2533 [21:34] <VoxelHead> Xais23: (win/dxdiag) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it in the IRC channel.
#2534 [21:34] <Wug> java seems to be fine
#2535 [21:34] <Wug> we've tried the current version ad\nd 6u27
#2536 [21:34] <GreyVulpine> Oh geez, is the the full stacktrace?
#2537 [21:34] <GreyVulpine> that*
#2538 [21:35] <Xais23> I'll have to come back to you guys either later tonight or tmmrw, I gotta go pick up my girl.
#2539 [21:35] <Wug> ever seen anthing like it before?
#2540 [21:35] <Ninja> alright well have fun xais
#2541 [21:35] <Wug> as far as I can tell, its creating the window, but its invisible.
#2542 [21:35] <GreyVulpine> Wug - I.. can't say I have..
#2543 [21:35] <Xais23> will do, have a good one. Till next time.
#2544 [21:35] <clarjon1> that's new
#2545 [21:35] <Ninja> what is that wug?
#2546 [21:35] <clarjon1> Wug: It seems that java is dying on creating the 2d interface...
#2547 [21:35] <GreyVulpine> Wug - What video card?
#2548 [21:35] <Wug> 260
#2549 [21:36] <Wug> this is WouldBeSaint
#2550 [21:36] <clarjon1> 260 what
#2551 [21:36] <GreyVulpine> Oh, the geforce gtx 260?
#2552 [21:36] <Wug> yeah
#2553 [21:36] <GreyVulpine> Hmm, have you looked into reinstalling vid drivers?
#2554 [21:36] <Ninja> holy clusterfuck
#2555 [21:36] <Wug> GreyVulpine: its a new install of windows 7
#2556 [21:37] <Wug> brand new drivers and all
#2557 [21:37] <Wug> also, thats when its trying to show the luancher
#2558 [21:37] <Ninja> holy shit what is wrong with this picture?
#2559 [21:37] <zkxs> ?
#2560 [21:37] <Wug> I have this feeling that java is completely unable to create windows
#2561 [21:37] <clarjon1> Wug: Does it run from browser?
#2562 [21:37] <Wug> no
#2563 [21:38] <GreyVulpine> I'm thinking it's a problem with the drivers..
#2564 [21:38] <Wug> I would assume it gets the same error message
#2565 [21:38] <Ninja> i dont even know what im looking at for wouldbesaint and i already know that there is something
#2566 [21:38] <TheNoodle> I'm thinking eggs for breakfast.
#2567 [21:38] <Wug> GreyVulpine: why would that stop the launcher from showing up
#2568 [21:38] <Ninja> *wrong
#2569 [21:39] <GreyVulpine> Wug - Is he running just a single display?
#2570 [21:39] <GreyVulpine> Nothing fancy?
#2571 [21:39] * neersighted [neersighted@notlogged] has joined #minecrafthelp
#2572 [21:40] <Wug> GreyVulpine: seems to be a single display but I'm using vnc so I'm not sure
#2573 [21:40] <Ninja> i dont even know what that stuff is but, i do know that that isnt good at all
#2574 [21:40] <Wug> I gave up on teamviewers boobery
#2575 [21:40] <GreyVulpine> Could you ask him?
#2576 [21:40] <Ninja> hey question
#2577 [21:41] <Wug> WouldBeSaint: ^
#2578 [21:41] <Wug> do you have a multi display setup
#2579 [21:41] <Ninja> this has nothing to do with any of what you guys are talking about tho
#2580 [21:41] <WouldBeSaint> Single display
#2581 [21:41] * Fiya [Fiya@notlogged] has joined #minecrafthelp
#2582 [21:41] <zkxs> do other games also encounter problems?
#2583 [21:41] <GreyVulpine> Hmm
#2584 [21:41] <Ninja> but how did you guys become moderaters?
#2585 [21:41] <WouldBeSaint> there is a newer driver set im downloading now
#2586 [21:42] * Doomkid14 [Doomkid14@notlogged] has joined #minecrafthelp
#2587 [21:42] <Wug> Ninja: by being here forever
#2588 [21:42] * guest-0-18146 [guest-0-18146@notlogged] has joined #minecrafthelp
#2589 [21:42] <Doomkid14> i need help
#2590 [21:42] <GreyVulpine> Ninja - Came here for help more than a year ago, stuck around, helped others, op was forced on me
#2591 [21:42] <Wug> :ar > Doomkid14
#2592 [21:42] <WugBot> Doomkid14: (ar) Ask a question, recieve an answer.
#2593 [21:42] * mib_0qibj8 [mib_0qibj8@notlogged] has joined #minecrafthelp
#2594 [21:42] <Ninja> really?
#2595 [21:42] <Doomkid14> why cant i update
#2596 [21:42] * GreyVulpine pokes Wug
#2596 [21:42] <GreyVulpine> "receive"
#2597 [21:42] * violoncello [violoncello@notlogged] has joined #minecrafthelp
#2598 [21:42] <Ninja> doom
#2599 [21:42] <GreyVulpine> Doomkid14 - Why can't you?
#2600 [21:42] <Doomkid14> ya
#2601 [21:42] <Doomkid14> ya
#2602 [21:43] * violoncello [violoncello@notlogged] has left #minecrafthelp
#2603 [21:43] <GreyVulpine> Doomkid14 - What happens when you try?
#2604 [21:43] <zkxs> i used to be voice, but then i didn't get on for a month and it expired
#2605 [21:43] <Wug> ffffuuuuuuuuu
#2606 [21:43] <Ninja> look are you trying to update to 1.9
#2607 [21:43] <Wug> ;~ ar Ask a question, receive an answer.
#2608 [21:43] <WugBot> Done.
#2609 [21:43] <zkxs> my nick was michl3545, you may recall me
#2610 [21:43] <Wug> ;+ receive yup
#2611 [21:43] <WugBot> Done.
#2612 [21:43] <Doomkid14> comes up with fatal error occured 4
#2613 [21:43] <Wug> ;+ recieve nope
#2614 [21:43] <WugBot> Done.
#2615 [21:43] <mib_0qibj8> I have just bought and downloaded the game, but when i try to get on the screen turns white and never loads up.......any solutions out there
#2616 [21:44] <Wug> :dx > mib_0qibj8
#2617 [21:44] <WugBot> mib_0qibj8: (dx) Press the Win+R keys, and type "dxdiag" (no quotes) in the box. Press enter. If prompted about verifying WHQL, select Yes. Once it has finished loading, click the "Save All Information" button and save it to your desktop.
#2618 [21:44] <WugBot> mib_0qibj8: (dx) Open the file you just saved, and copy the contents. Paste them on http://pastebin.com/ and click Submit. Then, copy the link you are sent to, and paste it here.
#2619 [21:44] <GreyVulpine> Doomkid14 - What is the full error you get?
#2620 [21:44] <Ninja> hold on you guys brb imma go irc client hunting
#2621 [21:45] <Doomkid14> 1 sewc
#2622 [21:45] <radeld644> Where can I find payment problem solutions?
#2623 [21:45] <Ninja> Grey any good irc clients that i should look into?
#2624 [21:45] <WouldBeSaint> Wug: looks like mib_0qibj8 is having similar issue :)
#2625 [21:45] <clarjon1> Ninja: yes
#2626 [21:45] <zkxs> irssi
#2627 [21:45] <clarjon1> Ninja: http://www.xchat-wdk.org/home/downloads
#2628 [21:45] <zkxs> lol
#2629 [21:45] <Wug> his is a grapgics card isue
#2630 [21:45] <mib_0qibj8> no Win keys on a mac?
#2631 [21:45] <Doomkid14> fatal error occurred (4):null
#2632 [21:45] <Ninja> lol
#2633 [21:46] <Wug> umm... crap
#2634 [21:46] <Wug> mib_0qibj8: what version of mac osx are you on
#2635 [21:46] <Wug> probably 10.5.8
#2636 [21:46] <GreyVulpine> Doomkid14 - I don't suppose you're running avira?
#2637 [21:46] <Wug> theres a known issue with that version
#2638 [21:46] <Doomkid14> ya
#2639 [21:46] <Wug> try one of the prereleases
#2640 [21:46] <Ninja> clarjon1 which one do i download?
#2641 [21:46] <mib_0qibj8> not sure really, im trying to figure this out for my son.... sorry
#2642 [21:46] <GreyVulpine> Doomkid14 - Yup. We've had 4 other people in the past week with avira and that problem
#2643 [21:47] <GreyVulpine> Doomkid14 - If you can wait just a minute, I need to look up the solution for it
#2644 [21:47] <GreyVulpine> ??< index
#2645 [21:47] <Wug> ?? win/avira
#2646 [21:47] <WouldBeSaint> Going to do a restart
#2647 [21:47] <WouldBeSaint> brb
#2648 [21:47] <Doomkid14> ok thanks
#2649 [21:47] * Silent_Samurai [Silent_Samurai@notlogged] has joined #minecrafthelp
#2650 [21:47] <Wug> wouldbesaint is restarting
#2651 [21:48] <GreyVulpine> Bah, I know vox had an entry for avira.. I can't remember it.
#2652 [21:48] <GreyVulpine> Sec, going to look through logs
#2653 [21:48] <clarjon1> Ninja: eh
#2654 [21:48] <mib_0qibj8> would Safari be what your looking for
#2655 [21:48] <Doomkid14> kk
#2656 [21:48] <Wug> GreyVulpine: just define another one?
#2657 [21:49] <Ninja> brb guys im going to go clear up my desktop
#2658 [21:49] <clarjon1> Ninja: xchat-wdk 1496-6
#2659 [21:49] <Ninja> yea but before i download that i need to make some space
#2660 [21:49] <Wug> Ninja: lol
#2661 [21:49] <mib_0qibj8> are you there mib?
#2662 [21:49] <GreyVulpine> ??+ avira|To stop Avira from blocking Mincraft, please do the following:;;Open Avira, open the Extras menu, and click Configuration. Then, set the switch to 'Expert' and open the 'Internet Protection' sub-menu, and open 'Web Protection', and then 'Scan'. Click 'Exceptions', and at 'URLs Skipped by Web Protection', enter 'http://s3.amazonaws.com/*', and click Apply then Add.
#2663 [21:50] <GreyVulpine> ??> Doomkid14 avira
#2664 [21:50] <VoxelHead> Doomkid14: (avira) To stop Avira from blocking Mincraft, please do the following:
#2665 [21:50] <VoxelHead> Doomkid14: (avira) Open Avira, open the Extras menu, and click Configuration. Then, set the switch to 'Expert' and open the 'Internet Protection' sub-menu, and open 'Web Protection', and then 'Scan'. Click 'Exceptions', and at 'URLs Skipped by Web Protection', enter 'http://s3.amazonaws.com/*', and click Apply then Add.
#2666 [21:50] <GreyVulpine> er, that should be Add then apply..
#2667 [21:50] * tyteen4a03 [tyteen4a03@notlogged] has joined #minecrafthelp
#2668 [21:51] <Wug> ;+ avira To stop Avira from blocking Mincraft, please do the following:;;Open Avira, open the Extras menu, and click Configuration. Then, set the switch to 'Expert' and open the 'Internet Protection' sub-menu, and open 'Web Protection', and then 'Scan'. Click 'Exceptions', and at 'URLs Skipped by Web Protection', enter 'http://s3.amazonaws.com/*', and click Add then Apply.
#2669 [21:51] <WugBot> Done.
#2670 [21:51] <Doomkid14> how do i open internet protection
#2671 [21:51] <Wug> ;search avira
#2672 [21:51] <WugBot> Matches for "avira": avira
#2673 [21:52] <GreyVulpine> You need to set avira to Expert for "Internet protection" to show up
#2674 [21:52] * Roy [Roy@notlogged] has joined #minecrafthelp
#2675 [21:52] <Doomkid14> dont have web portection
#2676 [21:52] * mib_v1xj85 [mib_v1xj85@notlogged] has joined #minecrafthelp
#2677 [21:52] <Doomkid14> found it
#2678 [21:54] <Doomkid14> so wait a sec after i go into web protection then what
#2679 [21:54] <Wug> just follow the directions and don't skip any steps
#2680 [21:54] <Doomkid14> ya i cant find my sacner
#2681 [21:55] <GreyVulpine> ?? avira
#2682 [21:55] <VoxelHead> avira: To stop Avira from blocking Mincraft, please do the following:
#2683 [21:55] <VoxelHead> avira: Open Avira, open the Extras menu, and click Configuration. Then, set the switch to 'Expert' and open the 'Internet Protection' sub-menu, and open 'Web Protection', and then 'Scan'. Click 'Exceptions', and at 'URLs Skipped by Web Protection', enter 'http://s3.amazonaws.com/*', and click Add then Apply.
#2684 [21:55] * iPixeli|Away [iPixeli|Away@notlogged] has joined #minecrafthelp
#2685 [21:56] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#2686 [21:57] <Doomkid14> so wait after i click on web protection then what cuz i cant find scan or exceptions
#2687 [21:57] * Sun7zu [Sun7zu@notlogged] has joined #minecrafthelp
#2688 [21:58] * WouldBeSaint [WouldBeSaint@notlogged] has joined #minecrafthelp
#2689 [21:59] <WouldBeSaint> so new drivers didnt help...
#2690 [22:00] <Wug> WouldBeSaint: its still doing exactly the same thing?
#2691 [22:00] <WouldBeSaint> yup
#2692 [22:00] <Doomkid14> wait when i click on expert mode sould a yellow square come up or a green 1
#2693 [22:00] <Wug> idk then, sorry
#2694 [22:01] * Daniel [Daniel@notlogged] has joined #minecrafthelp
#2695 [22:02] <Daniel> hey will someone help me out? i tried to buy the game with a mastercard but as soon as i filled out the information and hit enter it sent me back to the select payment. i dont want to try again because i dont want it to charge me twice
#2696 [22:02] <WouldBeSaint> that sucks... I just flushed 20 bux down the toilet...
#2697 [22:02] * neen [neen@notlogged] has joined #minecrafthelp
#2698 [22:02] <GreyVulpine> Doomkid14 - "Click the "plus" sign next to "WebGuard" in the left column. Click the "plus" sign next to "Scan." Click "Exceptions" to select and highlight it.
#2699 [22:02] <GreyVulpine> Read more: How to Make an Exception in Avira Antivirus | eHow.com http://www.ehow.com/how_7250842_make-exception-avira-antivirus.html#ixzz1ct2Nsjvk
#2700 [22:02] * mib_xj358h [mib_xj358h@notlogged] has joined #minecrafthelp
#2701 [22:03] <Wug> WouldBeSaint: if you use linux at all, it will probably work there
#2702 [22:03] <Wug> and it will work on other computers
#2703 [22:03] <Wug> and if you reinstalled windows (D:) it would probably work after that
#2704 [22:03] <mib_xj358h> will minecraft work on windows xp?
#2705 [22:03] <Wug> mib_xj358h: yes
#2706 [22:03] <Wug> though not very well at this point
#2707 [22:04] <Wug> the next version is being optimized and will work much better
#2708 [22:04] <WouldBeSaint> Thanks for all your help Wug
#2709 [22:04] <WouldBeSaint> I think Ill keep diging... If I find anything I let you guys know
#2710 [22:05] <Doomkid14> ok i just did all the step thanks
#2711 [22:05] <Daniel> hey will someone help me out? i tried to buy the game with a mastercard but as soon as i filled out the information and hit enter it sent me back to the select payment. i dont want to try again because i dont want it to charge me twice
#2712 [22:05] * Me4502 [Me4502@notlogged] has joined #minecrafthelp
#2713 [22:05] <mib_xj358h> but when i download the game when i press on it it askes ne for the ussername and password i put it in and it sais its wrong and i know its right. What do i do?
#2714 [22:05] <GreyVulpine> Doomkid14 - Did you add - http://s3.amazonaws.com - to the exceptions list?
#2715 [22:05] <Doomkid14> dam it didn't change it. it stil happens
#2716 [22:06] <GreyVulpine> er
#2717 [22:06] <Doomkid14> ya
#2718 [22:06] <GreyVulpine> http://s3.amazonaws.com/*
#2719 [22:06] <GreyVulpine> Added that to the list, then hit apply?
#2720 [22:06] <mib_xj358h> but when i download the game when i press on it it askes ne for the ussername and password i put it in and it sais its wrong and i know its right. What do i do?
#2721 [22:07] <Wug> mib_xj358h: what exactly does it sday
#2722 [22:07] <Wug> say*
#2723 [22:07] <mib_xj358h> that i can not conect to mincraft.net
#2724 [22:07] <Doomkid14> god dam it
#2725 [22:07] <Wug> mib_xj358h: does your windows username have any '!'s in it
#2726 [22:07] <mib_xj358h> no
#2727 [22:08] <Wug> has it ever in the past?
#2728 [22:08] <mib_xj358h> no
#2729 [22:08] <Wug> then its probably a firewall issue
#2730 [22:08] <GreyVulpine> Doomkid14 - If that doesn't work, try uninstalling avira
#2731 [22:09] <mib_xj358h> so what do i do?
#2732 [22:09] <Wug> :win/xp/firewall > mib_xj358h
#2733 [22:09] <WugBot> mib_xj358h: (win/xp/firewall) Follow these instructions to add an exception to the Windows Firewall for both Java and Minecraft on a computer running windows XP: http://support.microsoft.com/kb/842242
#2734 [22:09] <Doomkid14> WOOOT
#2735 [22:09] <Doomkid14> it works
#2736 [22:09] <Doomkid14> yay
#2737 [22:09] <Doomkid14> thanks so much
#2738 [22:09] <mib_xj358h> ok thankyou!
#2739 [22:10] <Daniel> hey will someone help me out? i tried to buy the game with a mastercard but as soon as i filled out the information and hit enter it sent me back to the select payment. i dont want to try again because i dont want it to charge me twice
#2740 [22:10] * mib_fj1h28 [mib_fj1h28@notlogged] has joined #minecrafthelp
#2741 [22:10] <Wug> Daniel: whats your account name
#2742 [22:10] <Daniel> dda995
#2743 [22:11] <Wug> and did you get a payment confirmation by email
#2744 [22:11] <Wug> !paid dda995
#2745 [22:11] <mib_fj1h28> Hello. Can diamond be mined with a stone pickaxe?
#2746 [22:11] <Wug> mib_fj1h28: nope
#2747 [22:11] <Wug> iron or better
#2748 [22:11] <Daniel> lemme check
#2749 [22:11] <mib_fj1h28> k thx bro
#2750 [22:11] <GreyVulpine> You can destroy the block, but you won't get the diamond ore as pickup
#2751 [22:11] <Daniel> if i dont have one, does it mean that it didnt charge me yet?
#2752 [22:11] <mib_fj1h28> if wasnt for this i would be ticked off right now lol
#2753 [22:11] <Wug> Daniel: that is correct
#2754 [22:11] <Wug> no confirmation == no purchase
#2755 [22:11] * Cryp71c [Cryp71c@notlogged] has joined #minecrafthelp
#2756 [22:14] <Wug> !paid dfgdsfgsrtg
#2757 [22:14] <Wug> !paid dda995
#2758 [22:14] <Ninja> there ya go
#2759 [22:14] <Daniel> woa, haha
#2760 [22:14] <Daniel> pretty cool
#2761 [22:15] * fuogo [fuogo@notlogged] has joined #minecrafthelp
#2762 [22:15] * quibbit [quibbit@notlogged] has joined #minecrafthelp
#2763 [22:15] <Wug> payment hasnt gone through yet
#2764 [22:15] <fuogo> how do i install a minecraft 1.8.1 server on my windows 7
#2765 [22:15] * guest-0-42790 [guest-0-42790@notlogged] has joined #minecrafthelp
#2766 [22:15] <quibbit> i just bought mine craft and i ran it and it said there an error
#2767 [22:16] <fuogo> how do i install a minecraft 1.8.1 server on my windows 7
#2768 [22:16] <TheNytangel> !server
#2769 [22:16] <quibbit> due any of u know how due i fix this]
#2770 [22:16] <guest-0-42790> OMG THIS GIRL IS STRIPING ON HER WEBCAM= http://goo.gl/nAfL2
#2771 [22:16] <GreyVulpine> !k guest-0-42790
#2772 [22:16] * GreyBot kicked guest-0-42790 from #minecrafthelp (Reason: uest-0-42790 :<Kicks:846>)
#2773 [22:16] <TheNytangel> *cough*
#2774 [22:16] * guest-0-42790 [guest-0-42790@notlogged] has joined #minecrafthelp
#2775 [22:16] * VoxelHead kicked guest-0-42790 from #minecrafthelp (Reason: uest-0-42790 :Banned)
#2776 [22:16] <fuogo> thanks
#2777 [22:16] <Wug> nope
#2778 [22:17] <mib_xj358h> The website you gave didnt help
#2779 [22:17] <Ninja> i wanna click it sooooo bad lol but it will most likely give me a virus
#2780 [22:17] <Wug> :tv > mib_xj358h
#2781 [22:17] <WugBot> mib_xj358h: (tv) Teamviewer is remote access software, which enables other people to, with your permission, access your computer remotely and attempt to perform troubleshooting and diagnostics. Download and run teamviewer from here: http://www.teamviewer.com/en/index.aspx
#2782 [22:17] <WugBot> mib_xj358h: (tv) Once teamviewer has been downloaded, run it (you do not have to install it) and PM the person who asked you to get it your teamviewer ID and password, shown in the teamviewer window. Send the private message with /msg user ID: xxx yyy zzz pass: wwww
#2783 [22:18] <Ninja> just to see what happenes
#2784 [22:18] <Wug> yeah, dont
#2785 [22:18] <Ninja> but im not going to because im smart
#2786 [22:18] <Ninja> does that happen often?
#2787 [22:18] <mib_xj358h> what
#2788 [22:18] <mib_xj358h> ???????????
#2789 [22:19] <GreyVulpine> mib_xj358h - Follow Wugbot's instructions
#2790 [22:19] <Ninja> where people come on and post what that one dude did?
#2791 [22:19] <Wug> Ninja: not as often as you'd think
#2792 [22:20] <mib_xj358h> do you you think my acount dousnt work?
#2793 [22:20] <Wug> :directions > mib_xj358h
#2794 [22:20] <WugBot> mib_xj358h: (directions) Everything is explained in the directions. If you can't find it, look harder, its there somewhere. Just follow the directions and don't skip any steps.
#2795 [22:21] <mib_xj358h> ok but im telling you it dousnt work
#2796 [22:21] <TheNoodle> OMG!!! this girl is stripping on webcam! http://goo.gl/z8d1M
#2797 [22:21] <GreyVulpine> !k TheNoodle
#2798 [22:21] * GreyBot kicked TheNoodle from #minecrafthelp (Reason: heNoodle :<Kicks:847>)
#2799 [22:21] <Wug> I'm telling you it does, you're just doing it wrong
#2800 [22:21] <GreyVulpine> Erm, hmm
#2801 [22:22] * TheNoodle [TheNoodle@notlogged] has joined #minecrafthelp
#2802 [22:22] <TheNoodle> click iiiit
#2803 [22:22] <TheNoodle> :3
#2804 [22:22] * GreyVulpine pokes TheNoodle
#2804 [22:22] <Wug> http://www.catdiaries.com.au/wp-content/uploads2/2010/09/cat-facts.jpg
#2805 [22:22] <TheNoodle> inb4 I shortened the wrong url
#2806 [22:23] <TheNoodle> <3 google images
#2807 [22:23] * Wug adds an automatic link unshortener to wugbot
#2807 [22:24] <TheNoodle> noooo
#2808 [22:24] <Wug> I hate shortened urls
#2809 [22:24] <Ninja> hahahahahahaha what do you want me to do noodle?
#2810 [22:25] <Ninja> click it or something?
#2811 [22:25] * TheNoodle creates an infinite loop of shortened urls
#2811 [22:25] <Wug> I like being able to see what I'm clicking on
#2812 [22:25] <TheNoodle> Ninja, wug linked to the unshortened version
#2813 [22:25] <Wug> short urls are for twitter, and this is not twitter
#2814 [22:25] <Ninja> hahaha dude shortening the url is only going to piss him off
#2815 [22:26] <Ninja> and i dont advise that
#2816 [22:26] <TheNoodle> That's the idea ninja :P
#2817 [22:26] <Ninja> noooo
#2818 [22:26] <Wug> WugBot, kick the noodle because hes a derp
#2819 [22:26] <WugBot> the is not in the channel.
#2820 [22:26] <Ninja> noodle take it from me, don't
#2821 [22:26] <TheNoodle> lololol
#2822 [22:26] <Wug> saved by the typo.
#2823 [22:26] <TheNoodle> <3
#2824 [22:26] <Ninja> wug wait
#2825 [22:27] <Ninja> keep him around i like fucking with him
#2826 [22:27] <TheNoodle> Really ninja?
#2827 [22:27] <TheNoodle> Also, someone fix aubot... :P
#2828 [22:27] <Wug> .. wheres aunot
#2829 [22:27] <Wug> aubot*
#2830 [22:27] <Wug> abatuobtobut*
#2831 [22:27] <Silent_Samurai> >.>
#2832 [22:27] <TheNoodle> It's not opped :(
#2833 [22:28] <Wug> its not authenticated either
#2834 [22:28] <TheNoodle> mmhm
#2835 [22:28] <mib_xj358h> it didnt work :( im so sad cause i paid 22 buck and i cant play minecraft
#2836 [22:28] <Ninja> aboslutly noodle its funny watching you get almosted kicked hahaha
#2837 [22:28] <Wug> mib_xj358h: open teamviewer like I told you to
#2838 [22:28] <Wug> :tv > mib_xj358h
#2839 [22:28] <WugBot> mib_xj358h: (tv) Teamviewer is remote access software, which enables other people to, with your permission, access your computer remotely and attempt to perform troubleshooting and diagnostics. Download and run teamviewer from here: http://www.teamviewer.com/en/index.aspx
#2840 [22:28] <WugBot> mib_xj358h: (tv) Once teamviewer has been downloaded, run it (you do not have to install it) and PM the person who asked you to get it your teamviewer ID and password, shown in the teamviewer window. Send the private message with /msg user ID: xxx yyy zzz pass: wwww
#2841 [22:29] <mib_xj358h> ok
#2842 [22:29] <Ninja> * meee
#2843 [22:29] <Ninja> hahaha i fail
#2844 [22:30] <Ninja> i wasnt even trying
#2845 [22:30] <Ninja> wug has minecraft ever given someone a virus before that you know of?
#2846 [22:31] <TheNoodle> Not when it's downloaded from http://minecraft.net
#2847 [22:31] <TheNoodle> From anywhere else, chances are you got one.
#2848 [22:32] <Wug> Ninja: no
#2849 [22:32] <Wug> official builds do not contain viruses
#2850 [22:32] <Ninja> my friend has had minecraft downloaded from the minecraft website, and it just gave his dad's laptop as nasty virus that knocked his comp down from 32gigs of ram to the default 8gigs
#2851 [22:32] <Wug> viruses dont work that way
#2852 [22:32] <Ninja> and he has had minecraft longer then me
#2853 [22:33] <Wug> he probably either picked it up somewhere else or has no idea what he's talking about
#2854 [22:33] <mib_xj358h> didnt work
#2855 [22:33] <Wug> or both
#2856 [22:33] <Wug> mib_xj358h: aaaguguugauagugugugg you are a noob
#2857 [22:33] * bletch [bletch@notlogged] has joined #minecrafthelp
#2858 [22:34] * meeeeeee [meeeeeee@notlogged] has joined #minecrafthelp
#2859 [22:34] <Wug> stop doing that
#2860 [22:34] <Wug> or so help me I'll ban you forever
#2861 [22:34] <Wug> meeeeeee: did you download teamviewer
#2862 [22:34] <Ninja> i mean if i could get him on here to explain it to you i would. and he knows what he is talking about, like he knows how to make bots like yours, and more. and idk the exact details
#2863 [22:35] <Ninja> who is meeeee and how does he keep doing that?
#2864 [22:35] <meeeeeee> hay my mincraft my ussername and passward wont work and i cant get into the mincraft server
#2865 [22:35] <Wug> yes I know
#2866 [22:35] <Wug> you were just here
#2867 [22:35] <Wug> I was just helping you
#2868 [22:35] <Wug> now answer my question
#2869 [22:35] <Wug> meeeeeee: did you download teamviewer
#2870 [22:35] * Wug fizzles
#2870 [22:35] <Ninja> hahaha
#2871 [22:35] <TheNoodle> Ninja, I'm sorry but if he thinks he got a virus from minecraft, downloaded form an official source, he doesn't know what he's talking about.
#2872 [22:36] <TheNoodle> *from
#2873 [22:36] <Ninja> he said he got it from minecraft servering (his words) and he does trust me
#2874 [22:36] <meeeeeee> yes i know i was just her i pressed refresh and it made re come in to the chat
#2875 [22:36] * Wug crackles
#2875 [22:36] <GreyVulpine> meeeeeee - Did you download teamviewer from teamviewer.com?
#2876 [22:37] <TheNoodle> Ninja, get him in here.
#2877 [22:37] <meeeeeee> no i dont know what that is
#2878 [22:37] * Wug boils
#2878 [22:37] <GreyVulpine> meeeeeee - It's a remote desktop program which will allow us to help you on your problem.
#2879 [22:37] <TheNoodle> meeeeeee, run, while you still can.
#2880 [22:37] * Devo5 [Devo5@notlogged] has joined #minecrafthelp
#2881 [22:37] <GreyVulpine> meeeeeee - You've been told 3 times to get it, so that we may help you.
#2882 [22:37] <Wug> :tv
#2883 [22:37] <WugBot> tv: Teamviewer is remote access software, which enables other people to, with your permission, access your computer remotely and attempt to perform troubleshooting and diagnostics. Download and run teamviewer from here: http://www.teamviewer.com/en/index.aspx
#2884 [22:37] <WugBot> tv: Once teamviewer has been downloaded, run it (you do not have to install it) and PM the person who asked you to get it your teamviewer ID and password, shown in the teamviewer window. Send the private message with /msg user ID: xxx yyy zzz pass: wwww
#2885 [22:37] <meeeeeee> ok
#2886 [22:37] <Wug> meeeeeee: ^
#2887 [22:37] <GreyVulpine> meeeeeee - Please follow WugBot's instructions
#2888 [22:38] <Ninja> noodle i cant
#2889 [22:38] <meeeeeee> oh yeah i did download that it didnt work
#2890 [22:38] <meeeeeee> srry
#2891 [22:38] <Wug> GreyVulpine: do you want a url unshortener
#2892 [22:38] <GreyVulpine> meeeeeee - Did you give Wug the 9 digit ID and 4 digit password?
#2893 [22:38] <GreyVulpine> Wug - Eh, nah
#2894 [22:38] <Wug> what if it isnt automatic
#2895 [22:39] <Wug> because I really don't like short urls
#2896 [22:39] <meeeeeee> oh i didnt know i was soposed to do that srry
#2897 [22:39] * GreyVulpine shrugs
#2897 [22:40] <meeeeeee> id is 153 389 471 and the password is 6245
#2898 [22:40] * mib_qpzjog [mib_qpzjog@notlogged] has joined #minecrafthelp
#2899 [22:40] <TheNoodle> oh lawdy.
#2900 [22:40] * GreyVulpine walks.. away.
#2900 [22:40] <mib_qpzjog> hey i need help mine crft keeps on crashing for me dose anyone know y this hapopends and how to fix it?
#2901 [22:40] <Devo5> Hello all. I,m looking for help on my mincraft server. I log in and then select to play in the browser but the game window comes up with nothing but a little red cross in a box in the top left corner. I have update Java and removed the old versions but the problem is still there. Can anyone please help? Thank you
#2902 [22:41] <Wug> connecting
#2903 [22:41] <Wug> connected
#2904 [22:41] <meeeeeee> ok so what do i do
#2905 [22:41] <Wug> nothing, I'll do it
#2906 [22:41] <mib_qpzjog> anyone know?
#2907 [22:42] <meeeeeee> :j
#2908 [22:42] <WugBot> j: Current Recommended Java Version: http://goo.gl/h2OEh (Java SE Runtime Environment 6 Update 29)
#2909 [22:42] <Ninja> TheNoodle: all of his computers are down at the moment
#2910 [22:42] <Wug> dear god
#2911 [22:42] <TheNoodle> From the minecraft virus?
#2912 [22:42] <meeeeeee> this is cool
#2913 [22:42] * TheNoodle giggles
#2913 [22:42] <mib_qpzjog> ?
#2914 [22:42] <Ninja> yea
#2915 [22:43] <Wug> he has java 5
#2916 [22:43] * TheNoodle thinks wug needs a hug
#2916 [22:43] * TheNoodle hugs wug
#2916 [22:44] * Wug burns TheNoodle with his rage
#2916 [22:44] <TheNoodle> :O
#2917 [22:45] <Ninja> what version is java on now?
#2918 [22:45] <TheNoodle> Java SE Runtime Environment 6 Update 29
#2919 [22:45] <Ninja> and his is?
#2920 [22:46] <TheNoodle> Java SE Runtime Environment 5 Update x
#2921 [22:46] <Wug> thats like 34 years out of date
#2922 [22:46] <Wug> it was 1.5.0 btw
#2923 [22:46] <Ninja> oh googily moogily butt fuck holy shit
#2924 [22:46] * TheNoodle wishes aubot was authed
#2924 [22:46] <Wug> WugBot: kikc ninja swearing
#2925 [22:47] <Wug> saved again by a typo
#2926 [22:47] <Ninja> nooo please ill be a good boy <:)
#2927 [22:47] * meeeeee [meeeeee@notlogged] has joined #minecrafthelp
#2928 [22:47] <Ninja> i want to give you hug too but i really dont know how :/
#2929 [22:48] <Wug> http://downloadcenter.intel.com/Detail_Desc.aspx?agr=Y&DwnldID=9033&ProdId=865&lang=eng&OSVersion=Windows%20XP%20Home%20Edition*&DownloadType=
#2930 [22:50] <Ninja> why does he keep quiting?
#2931 [22:50] <Ninja> and wug
#2932 [22:50] <GreyVulpine> It's mibbit syndrome.
#2933 [22:50] * AndrewsPanda2 [AndrewsPanda2@notlogged] has joined #minecrafthelp
#2934 [22:50] <Ninja> who was the main moderator when you first got on?
#2935 [22:50] <Ninja> same question for you grey
#2936 [22:51] <meeeeee> .
#2937 [22:51] <Wug> his name is this ^
#2938 [22:51] <Ninja> who?
#2939 [22:51] <Wug> that guy
#2940 [22:51] <Ninja> meeeeee?
#2941 [22:51] <Ninja> that guy there?
#2942 [22:52] <Wug> mmhm
#2943 [22:52] <Ninja> like when you first got on the irc for help
#2944 [22:52] <Wug> meeeeee: once it finishes try again
#2945 [22:53] <Wug> it might ask you to restart
#2946 [22:53] <meeeeee> ok
#2947 [22:53] <GreyVulpine> Main moderator was the founder of this channel, Truewolves
#2948 [22:53] <GreyVulpine> He has since passed it along to me.
#2949 [22:53] <Wug> teamviewer jipped me out of 5 seconds >:(
#2950 [22:53] <Ninja> wait so you are the main man?
#2951 [22:53] * GreyVulpine nods.
#2951 [22:53] <Ninja> where did he go?
#2952 [22:54] <Wug> tw is still listed as the founder
#2953 [22:54] <Wug> he's still around sometimes
#2954 [22:54] <Wug> havent seen him in a long time though
#2955 [22:54] <GreyVulpine> He doesn't come onto #minecrafthelp anymore. Real life issues, computer issues, job... and he got tired of questions
#2956 [22:54] <Wug> -NickServ- Last seen : Nov 04 01:24:15 2011 (1 day, 18:30:12 ago)
#2957 [22:55] * Wug /monitor
#2957 [22:55] <Ninja> what kind of questions?
#2958 [22:55] <Wug> Ninja: the questions we get here
#2959 [22:55] <GreyVulpine> #minecrafthelp questions
#2960 [22:55] <Wug> meeeeee: you still there
#2961 [22:55] <Wug> or are you restarting
#2962 [22:55] <Wug> inb4 quit
#2963 [22:56] * Rehevkor [Rehevkor@notlogged] has joined #minecrafthelp
#2964 [22:56] <Ninja> i mean, if people would actually say thank you when you helped them out with stuff like that, then i would look forward to doing this
#2965 [22:56] <GreyVulpine> We'll get the occasional "Thanks"
#2966 [22:56] <Wug> I actually get told good things a lot
#2967 [22:56] <Wug> inflates my ego a bit
#2968 [22:56] <GreyVulpine> Some people actually get donation offers.
#2969 [22:56] * GreyVulpine has turned those down thus far
#2969 [22:57] <Ninja> but how often do people actually mean it when they say thanks
#2970 [22:57] * Wug has no way of receiving donations
#2970 [22:57] <TheNoodle> Wug you sexy mfo.
#2971 [22:57] <Wug> :receive
#2972 [22:57] <WugBot> receive: yup
#2973 [22:57] <TheNoodle> *mofo
#2974 [22:57] * Wug sqozzs TheNoodle
#2974 [22:57] <TheNoodle> \o/
#2975 [22:57] <Kealper> ohgodwhat?
#2976 [22:57] <Wug> Kealper: fix aubot
#2977 [22:57] <Ninja> <(^.^)>
#2978 [22:57] <GreyVulpine> Eh, if we actually spend a good portion of time on a problem, the thanks we get is usually sincere
#2979 [22:57] <Kealper> yeah, lemme kill it right now
#2980 [22:57] * meeeeeeee [meeeeeeee@notlogged] has joined #minecrafthelp
#2981 [23:00] * AuBot [AuBot@notlogged] has joined #minecrafthelp
#2982 [23:01] * Wug fizzles
#2982 [23:01] <meeeeeeee> id 153 389 471 password 6244
#2983 [23:01] <Kealper> bleh
#2984 [23:01] <TheNytangel> >.>
#2985 [23:01] <Kealper> meeeeeeee: right click the password spot and select to make a new password
#2986 [23:01] <Ninja> guys
#2987 [23:01] <Wug> ;check aquinas.student.rit.edu
#2988 [23:01] <WugBot> aquinas.student.rit.edu:25565 seems to host a minecraft server: Pinging Kealper is fun! ;3 (0/20)
#2989 [23:01] <Wug> \o/
#2990 [23:02] <TheNytangel> meeeeeeee, use /msg Kealper ID Pass
#2991 [23:02] <Ninja> remember my friend that got that virus?
#2992 [23:02] <Kealper> me? i just got here ._.
#2993 [23:02] <TheNytangel> Kealper, who then
#2994 [23:03] <Wug> TheNytangel: derp
#2995 [23:03] <Kealper> dunno, i just didn't want his computer getting remote shut-down by some kid thinking he's cool because meeeeeeee just put the teamviewer id and pass to like a ton of people
#2996 [23:03] * Kealper kicked VoxelHead from #minecrafthelp (Reason: oxelHead :VoxelHead)
#2997 [23:03] * VoxelHead [VoxelHead@notlogged] has joined #minecrafthelp
#2998 [23:03] <Ninja> TheNoodle you still there?
#2999 [23:03] <TheNoodle> mmhm.
#3000 [23:04] <Wug> I just /cs -o voxelhead
#3001 [23:04] <Wug> don't let me forget to reapply it
#3002 [23:04] <Kealper> vox isn't on it's own account
#3003 [23:04] <Wug> I had noticed -.-
#3004 [23:04] <Kealper> which is completely stupid in my opinion
#3005 [23:04] * TheNoodle looks at wug
#3005 [23:04] <Kealper> vox is using DG's account, so to deop vox means to deop DG
#3006 [23:04] <Ninja> my friend that got that virus on his comp while using minecraft?
#3007 [23:05] <TheNoodle> mmhm.
#3008 [23:05] <GreyVulpine> Ninja - Yes?
#3009 [23:05] <Ninja> well we think we know where it cam from
#3010 [23:05] <TheNoodle> mmhm...
#3011 [23:05] <Ninja> Bukkit -_-
#3012 [23:05] <TheNoodle> Nope.
#3013 [23:05] <TheNoodle> Bukkit did not give him a virus.
#3014 [23:05] * TheNytangel was wonderin who "DG" was until he remembered VoxelHead's creator
#3014 [23:05] <TheNytangel> Goddamn my stupid g button
#3015 [23:06] <TheNytangel> Stuck >:o
#3016 [23:06] <Thrae> Ninja: What damage did this supposed virus do?
#3017 [23:06] <Daniel> paid! dda9956
#3018 [23:06] <Daniel> paid! dda995
#3019 [23:06] <Wug> meeeeeeee: I think you need a graphics card upgrade
#3020 [23:06] <Ninja> hold on imma paste his stuff on here
#3021 [23:06] <Thrae> Daniel: !paid
#3022 [23:06] <Wug> I don't think you'll be able to play without it
#3023 [23:06] <meeeeeeee> how do i get that
#3024 [23:06] <Wug> You'd have to buy one.
#3025 [23:06] <Daniel> oh haha thanks
#3026 [23:06] <Daniel> !paid dda995
#3027 [23:06] <TheNoodle> "it just gave his dad's laptop as nasty virus that knocked his comp down from 32gigs of ram to the default 8gigs"
#3028 [23:07] <Wug> its a hardware component, a part of the computer.
#3029 [23:07] <meeeeeeee> ok where should i buy one
#3030 [23:07] <Ninja> hold on
#3031 [23:07] <Daniel> dude like when i tried again it said it wasn't allowed to deduct 21.95 from my credit card
#3032 [23:07] <Kealper> TheNoodle: my brain hurts
#3033 [23:07] <Thrae> TheNoodle: Bwhahaa
#3034 [23:07] <TheNoodle> :D
#3035 [23:07] <Wug> if you have anywhere nearby that fixes computers, they would probably be able to help
#3036 [23:08] <Wug> or if you know anyone who is good with computers
#3037 [23:08] <Ninja> thats what he told me btw imma post his statuses on here and what he told me, so give me a sec
#3038 [23:08] <Ninja> Ok dads computer got a virus from minecraft servering. It plays music in the background, lags the screen and computer alot, think I deleted the source file, antivirus is sophia endpoint security, admin account is no longer admin account.
#3039 [23:08] <meeeeeeee> ok well im probobly gonna buy one tomorrow then
#3040 [23:08] <Ninja> Lol they thought they stopped me from being able to get into task manager by removing my admin privileges to remove my ability I remove the virus from running then delete the file but I still got a backdoor process terminator. It's called command prompt
#3041 [23:08] <Wug> Ninja: it came from somewhere else
#3042 [23:08] <Ninja> Spyware, adware, and Trojan. All came from running Minecraft servers. Took 30 minute to manually end process via command prompt, and there is still 1/2 of the Trojan still on there, and the spyware is near deletion. I can't try to delete anything else because my dads going to send it in to dell to make them fix it since it's under warranty and his company made an agreement on dell computers if they get viruses, dell has to resupply
#3043 [23:08] <Ninja> Sure, I was using Bukkit for my server so it mightve been something there. And it started showing signs yesterday
#3044 [23:09] <Wug> get an antivirus program
#3045 [23:09] <Kealper> wait, wat?
#3046 [23:09] <Wug> avast is free and is pretty good
#3047 [23:09] <TheNoodle> "his company made an agreement on dell computers if they get viruses, dell has to resupply" wat
#3048 [23:09] <Ninja> i know
#3049 [23:09] <Thrae> TheNoodle: Yeah, such an agreement exists, costs a good bit
#3050 [23:09] <TheNoodle> Ninja, he didn't get the virus from bukkit, or minecraft.
#3051 [23:09] <Ninja> im telling you guys so you know if it happens again
#3052 [23:09] <TheNoodle> And that is a stupid agreement.
#3053 [23:10] <meeeeeeee> wug so when i buy the graphic card and put in in the computer it should work right
#3054 [23:10] <TheNoodle> Ninja, it didn't happen in the first place.
#3055 [23:10] <Wug> meeeeeeee: you'll have to install the driver but yes
#3056 [23:10] * Chris2 [Chris2@notlogged] has joined #minecrafthelp
#3057 [23:10] <meeeeeeee> ok
#3058 [23:10] <Wug> your computer also has to be compatible with it
#3059 [23:10] <Wug> I can't check that from here
#3060 [23:10] <Ninja> how?
#3061 [23:10] <Ninja> if i could get him on here to talk with you about it, i would
#3062 [23:10] <meeeeeeee> so how much are graphic cards
#3063 [23:11] <Wug> which is why I recommend asking somewhere that fixes computers
#3064 [23:11] <GreyVulpine> Anywhere from 20 to 800 bucks
#3065 [23:11] <Thrae> TheNoodle: I used to work as a Field Tech doing mostly Dell warranty work, and with government contracts they had sweet deals...they didn't even have to send back HDDs due to security reasons (in fact, one place wouldn't even let me send back a laptop motherboard due to being a high-clearance place)
#3066 [23:11] <Wug> meeeeeeee: a graphics card capable of playing minecraft will cost probably about 50
#3067 [23:11] <Ninja> wow
#3068 [23:11] <TheNoodle> Good lord.
#3069 [23:11] <meeeeeeee> ok
#3070 [23:11] <Kealper> Thrae: wow lol
#3071 [23:11] <Thrae> meeeeeeee: Just make sure it's ATI or Nvidia, not some weird other chipset
#3072 [23:11] <Wug> however if you plan to play any more intensive games, it might just be cheaper to get a new computer
#3073 [23:12] <meeeeeeee> and what type of graphic card do i buy
#3074 [23:12] <TheNoodle> And ninja, if your friend thinks that minecraft or bukkit gave him a virus, he really doesn't know what he's talking about. Sorry dude.
#3075 [23:12] <Ninja> alright well i guess we can leave that at that
#3076 [23:13] <meeeeeeee> no minecraft is the only one i need to lay
#3077 [23:13] <Thrae> Kealper: Yeah, it was fun being in there -- they were a DOD or NSA contractor and they had to turn on the flashing red light to show someone with no clearance was walking around
#3078 [23:13] <meeeeeeee> *play*
#3079 [23:13] <TheNoodle> Wow, that's odd :P
#3080 [23:13] <Ninja> really?
#3081 [23:13] <Thrae> Use of a flashing red light to show un-cleared people is typical with high-clearance business
#3082 [23:13] <Kealper> speaking of high-clearance stuff
#3083 [23:14] <Devo5> Hello all. I'm looking for help. I log into minecraft and then select to play in the browser but the game window comes up with nothing but a little red cross in a box in the top left corner. I have updated Java and removed the old versions but the problem is still there. Can anyone please help? Thank you
#3084 [23:14] <Kealper> my laptop has a chip in it that is used for the secure generation of encryption keys D:
#3085 [23:14] <TheNoodle> I know it's normal, it's just suprising :P
#3086 [23:14] <Wug> ;check aquinas.student.rit.edu
#3087 [23:14] <WugBot> aquinas.student.rit.edu:25565 seems to host a minecraft server: Kealper Kealper Kealper Kealper Kealper Kealper Kealper Kealper Kealper Kealper Kealper ;3 (0/20)
#3088 [23:14] <Thrae> Devo5: Are you using Windows?
#3089 [23:14] * Kealper stabs WugBot
#3089 [23:14] <Devo5> yes
#3090 [23:14] <TheNytangel> So much stabbing...
#3091 [23:15] <Thrae> Kealper: "Secure Generation"? A lot of processors have stuff like AES acceleration
#3092 [23:15] <Wug> ;check aquinas.student.rit.edu
#3093 [23:15] <WugBot> aquinas.student.rit.edu:25565 seems to host a minecraft server: Wugbot stabs Kealper back ;3 (0/20)
#3094 [23:15] <Devo5> I'm not sure?
#3095 [23:15] <Ninja> now you have to say it like richtofin
#3096 [23:15] <Wug> Devo5: use the downloadable client
#3097 [23:15] <Kealper> Thrae: it's a separate module that is put in, the name of it escapes me right now, lemme grab my laptop and look
#3098 [23:15] <Wug> :client
#3099 [23:15] <WugBot> client: You can download the client by clicking the correct link: (For Windows: http://minecraft.net/download/Minecraft.exe ) (For Linux: http://Minecraft.net/download/minecraft.jar ) (For OSX: http://Minecraft.net/download/Minecraft.zip )
#3100 [23:15] <Thrae> Devo5: Go to WugBot's link and download both x86 Offline and x64
#3101 [23:15] <Ninja> or however you spell it
#3102 [23:15] <Thrae> :j
#3103 [23:15] <WugBot> j: Current Recommended Java Version: http://goo.gl/h2OEh (Java SE Runtime Environment 6 Update 29)
#3104 [23:16] <TheNytangel> Wug, what's wrong with AuBot's !client?
#3105 [23:16] <Kealper> !client
#3106 [23:16] <Wug> TheNytangel: I've been here for while today and aubot wasnt working
#3107 [23:16] * TheNytangel thinks Wug ripped it off from AuBot
#3107 [23:16] <TheNytangel> >:o
#3108 [23:16] <TheNytangel> I didn't make it, you did
#3109 [23:16] <Wug> TheNytangel: I did, its an exact copy
#3110 [23:16] <Kealper> yeah, aubot was mega-broke today and i was doing a kind of high-stakes thing most of the day so i was not able to tend to aubot
#3111 [23:16] <Devo5> Thanks Thrae, I'll give it a try. I'm only 11 and not really good at this yet, still learning.
#3112 [23:17] <meeeeeeee> devo5 wug really helped me so good luck
#3113 [23:17] <meeeeeeee> hay devo5 im 11 to ha small world
#3114 [23:19] <Devo5> Thanks
#3115 [23:22] * Ninja thinks that was kinda akward
#3115 [23:23] <Devo5> Whoops, trying to get to Wugbots link, I don't know what to do?
#3116 [23:24] * TheNytangel` [TheNytangel`@notlogged] has joined #minecrafthelp
#3117 [23:24] <Ninja> alright if i leave ill brb
#3118 [23:25] * asnoehu [asnoehu@notlogged] has joined #minecrafthelp
#3119 [23:25] <Ninja> brb
#3120 [23:26] * Ownerthugz [Ownerthugz@notlogged] has joined #minecrafthelp
#3121 [23:26] <Ownerthugz> Hey guys
#3122 [23:27] <Ownerthugz> Anyone able to help with servers?
#3123 [23:27] <TheNytangel> Mmhm
#3124 [23:27] <Ownerthugz> okay
#3125 [23:27] * XantuVolo [XantuVolo@notlogged] has joined #minecrafthelp
#3126 [23:28] <Ownerthugz> I think my server is portforwarded, and the server.properties is set to online mode
#3127 [23:28] <Ownerthugz> my friend can't connect, it says connection refused
#3128 [23:28] <Chris> ownerthugz, type !check
#3129 [23:28] <Ownerthugz> !check
#3130 [23:28] <Chris> mmkay, did you set the server-ip?
#3131 [23:28] <Ownerthugz> in properties?
#3132 [23:28] <Chris> yes
#3133 [23:29] <Ownerthugz> so I type my external ip there?
#3134 [23:29] <Chris> nope
#3135 [23:29] <Chris> don't set it
#3136 [23:29] <Ownerthugz> yea
#3137 [23:29] <Ownerthugz> thought so
#3138 [23:29] <Chris> okay, try logging in via "localhost"
#3139 [23:30] <Ownerthugz> I can log in fine.
#3140 [23:30] <Ownerthugz> It's my friend who can't.
#3141 [23:30] <XantuVolo> I have Minecraft 181 beta. I am haveing trouble trying to create a wheat farm. I keep trying all this stuff and none of its working can anyone help me??
#3142 [23:30] * AndrewsPanda [AndrewsPanda@notlogged] has joined #minecrafthelp
#3143 [23:30] <Chris> okay, try using 24.***** in locally
#3144 [23:31] * guest-684861-21418 [guest-684861-21418@notlogged] has joined #minecrafthelp
#3145 [23:31] <Chris> XantuVolo, did you plow the dirt using a hoe?
#3146 [23:31] <Ninja> guys
#3147 [23:31] <XantuVolo> Yes
#3148 [23:31] <Chris> does it plant?
#3149 [23:31] <XantuVolo> no
#3150 [23:31] <Ninja> wug!!!
#3151 [23:31] <Ownerthugz> nope
#3152 [23:31] <XantuVolo> and I have it right next to water
#3153 [23:32] <Wug> wha??
#3154 [23:32] <TheNytangel> Sunlight
#3155 [23:32] <TheNytangel> It needs sunlight
#3156 [23:32] <Ownerthugz> are you trying to plant seeds
#3157 [23:32] <Ninja> i just downloaded that irc client
#3158 [23:32] <Chris> and you're on webcat...
#3159 [23:32] <Ownerthugz> So chris, any more help you can give me.
#3160 [23:32] <Ninja> what network is this?
#3161 [23:32] <TheNytangel> Espernet
#3162 [23:32] <XantuVolo> yes trying to plant seeds and I have it right out in the open if its not night it gets all sunn all the time
#3163 [23:32] <Chris> did you try using your external IP locally?
#3164 [23:32] <Wug> XantuVolo: you have to till the dirt
#3165 [23:33] <Ownerthugz> yes
#3166 [23:33] <Ownerthugz> i did
#3167 [23:33] <Wug> put it indoors and put torches
#3168 [23:33] <Ninja> its not on the list of networks for the xchat thingy
#3169 [23:33] <Wug> if something walks on tilled dirt it breaks it
#3170 [23:33] <Ninja> WDK client
#3171 [23:33] <GreyVulpine> Ninja - /server irc.esper.net
#3172 [23:33] <Wug> Ninja: you can add it with the add button
#3173 [23:33] <GreyVulpine> /join #minecrafthelp
#3174 [23:33] <Wug> or you can do that thing greyvulpine said
#3175 [23:34] <GreyVulpine> /profit
#3176 [23:34] <XantuVolo> I have a diamond hoe how do I till just hit it with the hoe?? Because it just diggs it up like the pick
#3177 [23:34] <Ownerthugz> I can't check if it's portforwarded, but i've had a server before and it worked after a portforward
#3178 [23:34] <Wug> * profit :Unknown command
#3179 [23:34] <Ownerthugz> right click wit the hoe
#3180 [23:34] <GreyVulpine> XantuVolo - Right click
#3181 [23:34] <Ownerthugz> ton the grass
#3182 [23:34] * marchingsouth [marchingsouth@notlogged] has joined #minecrafthelp
#3183 [23:34] <Chris> Ownerthugz, try connecting via your external IP locally
#3184 [23:34] <marchingsouth> Hello, can anyone help me with a problem I am having making a server?
#3185 [23:34] <Chris> bukkit?
#3186 [23:34] <XantuVolo> ok I know the mouse click but hold oln ill try it again
#3187 [23:34] <Ownerthugz> I did.
#3188 [23:35] <Ownerthugz> Same error
#3189 [23:35] <Chris> okay, portforward is wrong then
#3190 [23:35] <Ownerthugz> Failed to connect to the server: connection times out: connect
#3191 [23:35] <marchingsouth> My friend and I are on a server I am running on our LAN, but everytime we try to mine or break something it instantly reappears, does anyone know what I am doing wrong?
#3192 [23:35] <Ninja> guyyyss what network do i use tho
#3193 [23:35] <XantuVolo> *on
#3194 [23:35] <GreyVulpine> marchingsouth - Op yourself, or move away from spawn
#3195 [23:35] <Ownerthugz> marching
#3196 [23:35] <Ownerthugz> yea
#3197 [23:35] <marchingsouth> op?
#3198 [23:35] <Ninja> because it has me using ChatJunkies
#3199 [23:35] <GreyVulpine> marchingsouth - /op yourname in the server's console
#3200 [23:36] <Chris> minus the /
#3201 [23:36] <GreyVulpine> erm, right
#3202 [23:36] <marchingsouth> wow thank you guys
#3203 [23:36] <marchingsouth> that worked perfectly
#3204 [23:36] <XantuVolo> Well Ill be a neuts butt I fell like a moron
#3205 [23:36] <Wug> well now you know
#3206 [23:36] <XantuVolo> *Feel
#3207 [23:37] * mib_3e9hxr [mib_3e9hxr@notlogged] has joined #minecrafthelp
#3208 [23:37] <XantuVolo> Thanks everyone for your help
#3209 [23:37] <mib_3e9hxr> its not letting me download the game so i cane play
#3210 [23:37] <mib_3e9hxr> can*
#3211 [23:39] <mib_3e9hxr> do you know why i cant download it?
#3212 [23:39] <mib_3e9hxr> do you know why i cant download it?
#3213 [23:39] * mib_3e9hxr [mib_3e9hxr@notlogged] has left #minecrafthelp
#3214 [23:39] <XantuVolo> exit
#3215 [23:40] <Ninja> brb -_-
#3216 [23:42] <marchingsouth> So you do all just hang around here helping people get started with mindcraft out of the goodness of your own heart?
#3217 [23:42] <marchingsouth> thats amazing
#3218 [23:44] * Jeff_ [Jeff_@notlogged] has joined #minecrafthelp
#3219 [23:44] <Jeff_> guys
#3220 [23:45] * itsmedamon- [itsmedamon-@notlogged] has joined #minecrafthelp
#3221 [23:46] <Jeff_> guys
#3222 [23:46] * kermi [kermi@notlogged] has joined #minecrafthelp
#3223 [23:47] <kermi> i cant make the pumpkins in to seeds why
#3224 [23:47] <Wug> I dont think you're supposed to be able to
#3225 [23:48] <Wug> break tall grass, it drops seeds sometimes
#3226 [23:48] <TheNytangel> Wug, not pumpkin seeds
#3227 [23:48] <kermi> i went to the wiki and it said i could
#3228 [23:48] <Wug> kermi: are you using the wrong version? is it prerelease only
#3229 [23:49] <kermi> ihave beta1.8.1
#3230 [23:49] <kermi> so
#3231 [23:50] <Wug> so if its a prerelease only thing, you'll need the prerelease of 1.9
#3232 [23:50] <Wug> link is in the topic
#3233 [23:51] <kermi> o ok
#3234 [23:51] <Wug> or is it
#3235 [23:51] <Wug> ?? 1/9
#3236 [23:51] <Wug> ?? 1.9
#3237 [23:51] <VoxelHead> 1.9: The 1.9 releases are not supported as they are known to be buggy and unstable. If you want to use them anyhow:
#3238 [23:51] <VoxelHead> 1.9: 1.9 prerelease Minecraft client: http://assets.minecraft.net/1_9-pre5/minecraft.jar -- 1.9 prerelease Minecraft server: http://assets.minecraft.net/1_9-pre5/minecraft_server.jar
#3239 [23:52] * mib_psam5u [mib_psam5u@notlogged] has joined #minecrafthelp
#3240 [23:52] <kermi> well also in mutiplayer my computer keeps geting the same error on this server i found
#3241 [23:53] * gerzel [gerzel@notlogged] has joined #minecrafthelp
#3242 [23:53] <kermi> it says javasoketsomthing somthing
#3243 [23:53] <kermi> what are you doing
#3244 [23:55] * b0xxy [b0xxy@notlogged] has joined #minecrafthelp
#3245 [23:56] <kermi> hello ANY ONE THERE
#3246 [23:57] <kermi> BYE
#3247 [23:57] <GreyVulpine> "javasoketsomthing somthing" tells us nothing
#3248 [23:57] <GreyVulpine> It's like saying, "I've got so and so an error, what's wrong?"
#3249 [23:57] <GreyVulpine> Our likely response, "it's broken, fix it."
#3250 [23:58] <kermi> go away
#3251 [23:58] <GreyVulpine> Gladly.
#3252 [23:58] <kermi> yay
#3253 [23:58] <TheNytangel> kermi, you just lost all of your help, may as well leave
#3254 [23:59] <TheNytangel> You won't tell us the error, we can't help you.
#3255 [23:59] <kermi> ill just ignore you
#3256 [23:59] <TheNoodle> You told one of the most competant people in this channel to go away. And you've decided to ignore one of the most attractive.